--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (36337 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        221        347   0   Internal    127    84        Good
atttcagaaaaaagatcactcattttactttgtgaattatattccttttttcatctttct
gggccagattgagactgtgttacatagtggcatgaaaagggaaagaactagattttgttc
tgcccacagcagcataaaggcaaggacatgtaactagcagacctcaggtcctgatcccag
GCTTCCAACATCCAGAGTGACCCCAGCATACTCAGAGATGAAGCCAGCTCTTCCACAGTG
GGTGGGCCCTTCTGTGGGCTTCAGCAGAGGGAGCTCGTGACCTTCTTACTGTTCCAGGCC
ACTCAAG
gtgaagcagggtagaggtgaggctgtgaggattaactgctatttcagatgaaagtaaccc
aaagcatcatgcacccaggtactctggaggaaacaggaaagggagaaaggggcagtcagt
aaatgtcaggccgagttagctgaatgattgaaagggcttccagatcaatggttaggatca

Exon  2 +       2804       2845   0   Internal     42    73        Good
tttcaactccattccccatgatcctcccaccatgccatattctctgggaagctctataac
attaacttttaagctttgcccactctggatggtggaattgttttaagtcagttcaaaaaa
atacatggagccttaatgtccctggcaatgccctccactgctgcctctttttgtctatag
CTTAAAGCCATATCTCCCTACCTCCTTCCTGCCTTTGATAAG
gtgagacctgtggcctgacaccagctatggatgactgagctcccaggatcttaggcttgg
acctgaagagtactggcagatcttttgctgagagcccagggaggacttggtggactccat
agtgcactcaggctccagctcaggaacctggggggctggcatgcctacatagtacagagg

Exon  3 +       4387       4495   0   Internal    109    88        Good
agtggaaagtaacagctcagcccatccctgggggttagtgggaaagagcaacccgaagac
tccccagggaacagtcctgttgcataccccagccacctctgaggggcaggtgacaataag
caccatgacaggcagcagcccagcagaaaccaaagccttcactgctgcctggagtcttag
GAATCCTTCACCCAGGACCAGTGTATCAGCCATCAAAACAGCCCCAGCCATAGTCTGGAG
GCTGGCAAAGAAACCTTCCACAGCACCCAGCACCTCAACAACCCCTACG
gtcagggcaaagctgaccatgcaggtccatcactgtgtggttgtgaagccaacccccagc
catgctcaccactccctccccaagcctcacaacagccctgctcccagaggagctcagtcc
tagtccctcagtgctgcctcccagcttgccagacctccaccccaagggagagtacccccc

Exon  4 +       4648       5240   1   Internal    593    88        Good
agcacccagcacctcaacaacccctacggtcagggcaaagctgaccatgcaggtccatca
ctgtgtggttgtgaagccaacccccagccatgctcaccactccctccccaagcctcacaa
cagccctgctcccagaggagctcagtcctagtccctcagtgctgcctcccagcttgccag
ACCTCCACCCCAAGGGAGAGTACCCCCCAGATCTGTTCAGTGTGGAGGAGCGGCGGCAGG
GCTGGGTGGTCCTGCACGTTTTTGGCATGATGTATGTGTTTGTGGCCTTGGCCATTGTTT
GCGACGAGTACTTCGTTCCAGCCCTGGGTGTCATCACAGACAAGCTGCAGATCTCCGAGG
ATGTGGCAGGCGCCACATTCATGGCTGCTGGAGGCTCTGCTCCTGAGCTCTTCACCTCCC
TCATCGGTGTCTTCATTTCCCACAGCAACGTGGGCATTGGTACCATTGTGGGCTCTGCTG
TGTTCAACATTCTCTTTGTCATTGGCACTTGTTCCCTCTTCTCCCGAGAGATCCTCAACC
TCACCTGGTGGCCCTTATTCCGTGATGTCTCCTTCTACATCCTTGACCTGATAATGCTCA
TCCTCTTCTTCCTGGACAGCCTCATTGCCTGGTGGGAGAGCCTGCTGCTGCTGCTGGCCT
ATGCCTTCTATGTGTTCACCATGAAGTGGAACAAGCATATCGAGGTCTGGGTGAAGGAGC
AGCTCAGCAGGAGGCCAGTGGCCAAGGTCATGGCCTTAGAAGACCTCAGCAAG
gtaaggacaaattggctcaggtttctctagcccctttgagatgaaaggatgtggcgaagc
caggacctgaagagaaggtgctggatcagacctcaagagatgaatgctctggttccctta
ctatttattcaacatttatagagtacctgttctctgccaggcactgtgctggggcctttg

Exon  5 +      11593      11655   0    Initial     63    46    Marginal
aagctcaacaagggaatgaagtaatgagagtcctccctagctgctgagtagagaatgaat
tgtaggtgtgcaagagtggaagcagggagtccagttaggaggctgttgtgggctgtttat
atgtatatgtatttgtgaatgttttaagacagaatcatctggacttggtgtgaagtggat
ATGGAGGGTGAGAGAATCAGGAAAATCAAGGATGATGCTGATCTTTTTGGCTTGAGCAGC
AGG
gtggatggtagtggcatccactgagaaagaagaataagtttagggagacactttggaata
gtgagtttgggtgcttaggtcacttccaagtgggtgtatctgggaggcagtggcacaaat
gagtctgaagcccaggaacaaagtctgggctggaaacagaaaattgtgaatcaccaacaa

Exon  6 +      17398      17588   0   Internal    191   100   Excellent
tgaagccagattatagaaggtcagactggagggatggaacatgttgaaacattttctgag
accaggttatctcggagtgtgtttctgtatttcaacctgaggacttccgtggagaaaggg
atgtagggagaaagtgagggtctcgccacaacatctcgtgactcctctccctgtttgcag
CCGGGCGATGGGGCCATTGCGGTGGATGAGCTACAGGATAACAAGAAGCTGAAGGTGGGT
GCCGTATGGAGTCTGCCCAGTGGGGACACTGCAGGGTCTCAGTGGATGATCACAGGCCCA
GGGTATTGTGGCCCTGTGCTGGGGACCCTGGCTGTGCTCAGGCCTAGGAAACTCCTGGGA
GCGCTGCCAGG
gtgaggcaagggaggagagggctctttttctgagaactctcacctctagatggcctttga
ggaggtgctagtttgggagctaagtctggaatgttacagtcctctctgccattagcttgc
tgtgtgaccttgagcttcagattctgcatctgtaaaatgactgtttgaactagatgaatt

Exon  7 +      18865      18973   0   Internal    109    95   Excellent
gctgagaaagaaagtagtgtaactcttctggttggaggtggaggaagaggggaggtcagg
ataaggcatctgtgctttctccctgatctttatgggaaagaggcaaggttagtgatgccc
tcgtgtggttcctcccctggcttggacaggggcccactgtgcggctctcctcttgctcag
CTCCCGTCCTTGCTGACCCGAGGGAGCAGCTCGACCTCTCTGCACAACAGCACCATCCGC
AGCACCATCTACCAGCTCATGCTCCACAGCCTGGACCCCCTGAGGGAAG
gtaagcaaggcctctccagacctttgtggtttgccccatccactccttccctcctgcagc
tggagaagaactgggacctgaaaatcctagaggcagtgaggagggagtgggaagagataa
taagcagaggaaagtagtaaaagtcagacagtctgggaaagagggtagagaccaagacag

Exon  8 +      23697      23783   1   Internal     87   100   Excellent
aattaggcaccacaactaggcctcgtaggatcagaatccagatgtcacaacccccatggc
agccttttcccacactctgcagctgccctctggctgctcagctgactgtcctaactgaaa
gggcgtggcagggatgatcctacaattccaggtaagatgtatgtcctgtctcatttgcag
TTCGCCTTGCCAAGGAGAAGGAGGAGGAGAGCTTGAATCAAGGGGCCAGAGCCCAACCCC
AGGCCAAAGCAGAAAGCAAACCAGAAG
gtgagaggatggccagaccagtgggttttctcctgcccccctctccctgctgtcagtagt
gagcttggcctggaggcagcagccagccaggccaggggctgaggcacatctttggcctct
gtgagccagtcagttagagtgatggtagggtgttgccctgatcgccgctccactccagac

Exon  9 +      24894      24973   1   Internal     80    82        Good
taacaattcacatcatcttacttttcctaccaacaagaaattcccccaaataaaccttca
gaaaccctgaagtccaatagccctgtagccacttatgccagtgtctctgccagcttcctt
cagaaccttgtccactcttctgatgtaacccatgtttatcctttaaagaggaggagccag
CCAAGCTCCCTGCGGTCACGGTCACACCAGCCCCTGTTCCAGACATCAAGGGAGATCAGA
AGGAGAATCCAGGCGGTCAG
gtaggcacccagccttggcacagacaaaattggagaggtctagggaaggaactcttgacc
aaaaatacatcctccctgaaggtctgaaatcctatttgaggttcattcctctgggggtaa
atattaccctttctctgaagatcacttgaaaaatacaagtatctcatggggccaattaac

Exon 10 +      29652      30212   0   Internal    561   100   Excellent
acagccactaggtaggagtgtggtcatgggaattctgctgaattatcgcactagttttct
cctcatacttaagttttcagataccttctgagaagcacgccaacaaaaaaatgggggagt
aacataaggaaaacaagcagagcagttaccacacattaatctgttggttttggattgcag
GAAGATGTGGCTGAGGCCGAGAGCACAGGTGAAATGCCAGGCGAAGAGGGCGAAACTGCT
GGTGAAGGTGAAACTGAAGAGAAAAGTGGAGGTGAAACTCAACCAGAAGGTGAAGGTGAA
ACTGAAACACAAGGAAAAGGAGAAGAATGTGAAGATGAAAATGAAGCAGAAGGAAAAGGA
GACAATGAAGGTGAAGATGAGGGTGAAATCCACGCAGAAGATGGTGAAATGAAAGGTAAT
GAAGGTGAAACTGAAAGCCAGGAACTCAGTGCTGAAAATCACGGTGAAGCCAAAAATGAT
GAGAAAGGTGTAGAAGATGGAGGGGGAAGTGATGGAGGGGATAGCGAAGAGGAGGAAGAG
GAGGAGGAAGAGCAGGAGGAAGAGGAGGAGGAGGAAGAGCAGGAGGAAGAGGAGGAGGAG
GAGGAGGAAGAGGAGGAGAAGGGAAATGAAGAGCCTCTGTCCCTGGACTGGCCTGAAACC
AGGCAGAAGCAGGCCATTTACCTCTTCCTTCTGCCCATCGTGTTCCCACTGTGGCTGACA
GTCCCCGACGTCCGAAGGCAG
gtgagtgtgcccatctgtatctcagactctttatccccagcagggctgtggggtctctcg
gcatgcggggctcacactcaagaggaggaagaggccagggacaaccagcttatcagggct
ccaccattgagatctgggaagggactgaagccttggagggggactatgtgcttaggggac

Exon 11 +      31912      32082   0   Terminal    171    96   Excellent
cttgctcttcctctctgtggccatctcagctgtcggtccccctatcacccttcctcactc
aggctgagggggtgtggctgagctccttagaaggcagtctgtttgcacaaagtaggatgt
ggatagtgcttggatgtgcctcaggtttttcacctactgttgaccgttgccgtttaccag
GTTGGTGAAACAATAGGGATTTCTGAAGAGATCATGGGCCTGACAATCCTTGCAGCAGGC
ACATCAATTCCTGACCTCATCACCAGTGTGATTGTCGCTCGAAAAGGCCTGGGAGACATG
GCTGTGTCAAGCTCTGTGGGCAGTAACATATTTGATATCACTGTGGGGTGA
gtggcaatgtaactttctaaggggtgttaagtatgactggaaaacactgcattggctctg
ttcactggttttctgctttattcattatacatagaataaaagggcatttatattgttagt
ttctgcaaagcaacaaaatatcttcccttcattcatcatagccagatgggataatagacc

Exon 12 +      33597      33871   0    Initial    275    40        Poor
accctaatgaaagaatgtatatgatcctggaaagtgaactgggtgacctaggacctctga
tatgaatgtgatctgagactaaagtttgtccttggaaacacctgcagctcattgtggatt
aagaacctcacccctggaggggtggagtttctacccctgactcatgcagacatctattac
ATGGAGGCAGTAGAAGGACCCCTGGAGCCAGAGGGTTTTCTAAATGAGATAACTGGGGGC
AAAGGTTGGGATAGGCGCAGCAGCTATAAGACAAGCTCCTACGCTCACTGTTCCCTGATC
ATTCCAAAGGCTGCTGGCCCAAAAGATGCAGATGTGGTCTACATCTCAGCCTTCCTGACC
TCTGCCCCAAACACACGCTGCAATTTTGTCTCCTCCTTTTCTGTTCAAATTGTGAGGTTC
TATCAGGTTTGTAATCACTGTAGCTTCAGTTATTG
gtgagtctaaggatccaaggctacagaaaaaaaagaaatataacaggaattaatgatcat
tccacgttttgtagcccactgcatctggatatataccagtattttctttttttttttttt
tgagacagagtttggctcttgttgcccaggctggtgtgcaatggcgtgatctcggcacac

--------------------------------------------------------------------------------