--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6100 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        182        225   0   Internal     44    94   Excellent
actccagcctgggcgacagcaagactccgtctcaaaaacaaaaacaaaaacaaaaaccct
gatctttcacttcgggcctgacagcagcttgactggaagtttgctcccgcagttctgaga
ttctggccttttcttttgtcccattggtactttttgctgccagggtttcctgtccttcag
GTTTCCATCCCCAATCAGTTGAGAGTCCGACTGGAGTACCCAAG
gtgcgttgaggaatgaggcacagccctgggcttaactcatccagcctggccagctcagcc
ttcccctgtcaggtgggagcctaggattgctgtcagcccagggagcagagttggaagaag
ggggcagggccctacctaggctgcggcccatcggggcagcctgcgctggtggcttcggaa

Exon  2 +       1522       1673   0   Internal    152   100   Excellent
ggctggagcgcaacgggccggcggcttccgcattaagcccggcgcccggcactgtttagc
cgggccctctccggctcagcgcagccggcggtccccaaccacaccggccggggctcggcg
ccgcactcttcccagaaggttgcgctggctcgtgagtgatcctgtcctctccacccgcag
GGCCGCGTTCGCACCAAAACCGTGAAGAAGGCGGCCCGGGTCATCATAGAAAAGTACTAC
ACGCGCCTGGGCAACGACTTCCACACGAACAAGCGCGTGTGCGAGGAGATCGCCATTATC
CCCAGCAAAAAGCTCCGCAACAAGATAGCAGG
gtgagtcgggccttcctcggcctccggggctccgcgatctgtttgtgtgctctgccgccc
tccgactcgggaagagacggtgccttggtggtttcgttagcctgagactccctggtgtcc
cggagaagggctagagctctgcgtgtgcaggatttctgttgtgaacttaggcctgtgtca

Exon  3 +       2669       2774   2   Internal    106    82        Good
gggaaggaatgctcaggccagtggaggttctatgtgtaggaggtcccaggatagtgagtc
ctcttccttctcactgtggaaaagaactaaagcgggtatttatatatgcacatgtgctca
gtaccaggtgggagttgatttgtcttctcactgttctctttggctgtgtgtgctttgtag
TTATGTCACGCATCTGATGAAGCGAATTCAGAGAGGCCCAGTAAGAGGTATCTCCATCAA
GCTGCAGGAGGAGGAGAGAGAAAGGAGAGACAATTATGTTCCTGAG
gtaaactttctggatatttgggcttctggctaatcctcaaatgataaagctatgggttct
tggcttccaaagggacctcagctgaatctgagacctttaatccatacattccataaccag
ctgtgggtgcccataggccccctaccagtttcttagcctccattctgctcttctggaacc

Exon  4 +       3283       3348   0   Internal     66   100   Excellent
aaggccagaagaacaggtcatcggggtctgtaatactgtaagagactgctcaccttgtga
gaggaatgctatccttgtgcagctcctcttccccatatttaagaacctggggagaggagg
aggagaggtgagtgataatctcattgattggtattttgaccctacctcgtttccttgtag
GTCTCAGCCTTGGATCAGGAGATTATTGAAGTAGATCCTGACACTAAGGAAATGCTGAAG
CTTTTG
gtaagtgtttgctggattcctaaagtggtattttcctggtcaaaaaccatcagtaggtct
tattatccaaggtcacccagctagtaagtggcagagttgggaatcccatctaaacttgta
gccactaaactggactgctttcataaggggtgtagcggaagttgtgtgcattgagttagt

--------------------------------------------------------------------------------