--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (117729 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      14540      14642   0    Initial    103    48    Marginal
ttcctccaaaagttaaatgttgttaccatatgacccagcagttctgctcctagcgatata
tctggtagaattgaaagtatatgtctgcacaaaaacttgtacaccgttattcatagcagc
attatttataatagtcaaagtggaatcaactcagatgtctatcacctgatgaatgggtaa
ATGAAATGTGGTGTATCCATACAGTACAATATTATTCAGCCAAAAAAGGATGAAGTACTG
ATTAATGTTATAACCCAGATGAACCTTGAAAACATCATGTTAA
gtgagagaagccagacacagaaagctacagattgtataattgtatatttccagaataggc
aaattccatagagacagaaagtagatgagtatttgctggggactagggagaggaaggagt
ggggaatgcctgctaatgagtatcaaatttctttttgggatgataaaaatgttctataat

Exon  2 +      36728      36918   1   Terminal    191    72        Good
aactatggtccatgggctggccatctgttattgtaaataaagttttattagagcactgtc
atgctcattcatttacatattgtctatggctgctttcgcattataacaacagaattgagt
agttgccccagaaactatatggtccataagcgtaaaatgtttactctctgacacttttag
AAAAAGTTTACCAACTCCTTAGTTCAGAAGAAAGAAGGAAAAATAATTTCATAGCATATT
ATAAAGGAACTACTGGAGAGATGCTATCTCTGGGAAAGTTGCGTATCAGGAGAAGTTTCA
AGAACAAGTGGTTTCAGAAAGTTTACCAGGAACAGAACGAAACTGAAGATGTGTTCTGCA
AATCTGAGTAG
taattcactggaatatagatataattggagataaaactcaactgagcagcctgtaaggaa
gttggtgggagagatgagggttgcccatagactgaattaaagaggaggccctggtttcaa
ctcatgaagattgttcaacaaagacataaggcccacacagtatgattcattatgaaggtt

Exon  3 +      48335      48508   0    Initial    174   100   Excellent
gagagggaaggctcatatggaggacaaagctgggaaccttttccatctttgaaatctggc
tcagtattaagaagaagattcatcttcagatagcccatattcaagtactactaatgcttt
taataaaaatataccttttttattgtttaggtcacttttacaaagagaaagtttggatta
ATGAAGAAAGCCTATGAACTTAGTGTGCTCTGTGACTGTGAAATAGCACTCATCATTTTC
AACAGCTCTAACAAACTGTTTCAATATGCTAGCACTGATATGGACAAAGTTCTTCTCAAG
TATACAGAATATAATGAACCTCATGAAAGCAGAACCAACTCGGATATTGTTGAG
gtaacacatatctagtaatacgtgaattgcaagtaatactgaaatattttgtttaatagc
attaactgtcagaatgacttgtacatctaaaacataaattaggtgtatatgtatcttttc
tctaaatcatttcttagaagagtgattgctgtatggcgactcacttgtgttataaacata

Exon  4 +      55025      55198   0    Initial    174    44    Marginal
gaggatggagataaagttgctctagaggtgatgctatcaccagagttctttaaagcagca
gtccccaaccttgttggcaccagggatgggggttgggggtgggaggaatgtggacaggga
gatggttttgagatgaaattgttccacctcagatcatcaggcattagattctcataagga
ATGGGCAGCCTAGATCCCTTGCTCGTGCAGTTCGCAGTAGGTTTCATTCTCTTACGAGAA
TCCAATGCTGCTGCTGATGTGACGGGAGGCAGAGCTCAGGCAGTAATGCTCACTTGCCCA
CCACTTACTTCCTGCTGTGCAACCTGGTTCCTAACAGGGTCTGTGGCCCCGGGG
gttagggacccttgctttaaaggttatggtaggtggaaaacaaagatgctctaggtcaga
ggggcagcttatatggaaattaggaaatgagacactgcagttagtgtacgaagttgaaat
cagccaagtgtcactgtagtatactgtgaagagtggaatagctaagacctgagaagtaaa

Exon  5 +      63615      63704   0   Internal     90    91   Excellent
tagcattacttatactaatacagagattaaatctagtgatatgtagaagagataatatat
tatgactaagttgaatgtatcctagtagagttataccatattcatagatcagaagtctca
aattatatatatctgtgccacataagataatctctgtagagttgatgaaatatcaatcag
AATCCCAAGAAATACTTTTTGAAAGAACTTCAACAACTGATTCTAAAGTTCACAGAGAAA
ATAGAACAGAAGACACTGAAGAAGAACAAG
gtgagagggtttgcactgcaatatattgagactaattttaaagctataataatgaacata
cagtggcagtggcacaaataccaaatgccaaacgtaccaatggaataatagctcagaaac
aggaccatgcatatttagatacttaatatatgatagagtggcagaacaaactccttaagc

Exon  6 +      68524      68684   0    Initial    161    49    Marginal
agagcttctgcacagcaaaagaaactttatcatcagaatgaacaggcagcctacagaatg
ggagaaaatttttgcgatctatccatctgacaaagggttaatatccggaatctacaaaga
acttaaatttacaaaaaaaaaaaaaaaaaaaaaaaagccatcaaaaagtgggtgaaggat
ATGAACAGACACTGCTCAAAAGAAGACATTTATGCAGCCAACAAACATATGAAAAAAAGC
TCATCATCACTGGTCATTAGAGAAATGCAAATCAAAACCATCATGAGATACCATCTCAAG
CCAGTTAGAATGGTGATCATTAAAAAGTCAGGAAACAACAG
gtgctagagaggatgtggagaaatgggaacacttttatactgctggtgggagtgtaaatt
agttcaaccatggtggaagacagtgtggtgattcctcaaggatctagaactagaaatacc
atttgacccagtaatgccattactgaatatatacccaaaggattataaatcattctactg

Exon  7 +      71481      71606   0     Single    126    54    Marginal
agtaatagctatagagagtactcagtgctagcactcttgatgcatttttctactttttct
ttatgaggaataagcagatctctcatagtggtgacctttcacactgtgttttcctcattg
agcaagtgtctttattgtggctaacttgtgtgtgagaaaactgaagctggccaggatcgt
ATGTACCTGGGCCTGGCCTTCTTAATAGATTACGGCATTCCACTTGATAATACCAGTGGC
ACAGGAGAAACTTCTACTGTTGTGCTATTTGGTAATGTGAAGACAGAAAAAGTCTTTTTA
TGGTAG
ttgggtcctcaaaacaactcttcatggtttagtgataaggagacacaagttgcctatcaa
acagaggtacattagcttattatctacaaagctgatagagcctcttaaattctctcatgg
tgacagaaaccccatctgaagtgaaggcttgcagagctggagataccagagcactttcct

Exon  8 +      74067      74198   0   Internal    132    90   Excellent
tacttatatttaatgtttatcttatttgaagaagtaagtacatttgtgatcatttagaaa
ccgtttcagtggctcttgtataattcagttcattccgtctgtgctctcttaataaatttt
acagaaaaactcatggcaagttagcattatttgtgtgtgaattttccaattgtatttcag
ACTTTAAGAAAGAAAGGCCTTAATGGTTGTGAGAGCCCTGATGCTGACGATTACTTTGAG
CACAGTCCACTCTCGGAGGACAGATTCAGCAAACTAAATGAAGATAGTGATTTTATTTTC
AAACGAGGCCCT
gtaagtacttttactttacctctactttttatttgttgatcctttttgttaacttcatta
tttaggctctgaacaagaaggaacacagagggtgcgacagcccagaccctgatacttcat
atgtgctaactccacatacagaagaaaaatataaaaaaattaatgaggaatttgataata

Exon  9 +      74264      74405   0   Internal    142   100   Excellent
ccttaatggttgtgagagccctgatgctgacgattactttgagcacagtccactctcgga
ggacagattcagcaaactaaatgaagatagtgattttattttcaaacgaggccctgtaag
tacttttactttacctctactttttatttgttgatcctttttgttaacttcattatttag
GCTCTGAACAAGAAGGAACACAGAGGGTGCGACAGCCCAGACCCTGATACTTCATATGTG
CTAACTCCACATACAGAAGAAAAATATAAAAAAATTAATGAGGAATTTGATAATATGATG
CGGAATCATAAAATCGCAGTGA
gtactaaagtatggtttgtgcttttatcttgtgcatgaagagattgaccaaacatcttgt
tgcttatttttatagtgggtgatgacaacaataagtagaagggaagaaatgcattttatt
agtattttttataaaacttcaaaataaaattgctgaaatcttatacatgttcagtatctt

Exon 10 +      77879      77944   2   Internal     66    67    Marginal
tgattggagttagagtatcttttacatctcctcctgcctgaattacttcattaattcagc
aaaatttatgttacatttattgtattagtctatgaaatgcagtgtctcctctctcttaag
tcctagatttaatttagtgatttaatcatactccttacacactgcccccgtttttatcag
TATGTACTATTTTGGTATTGATGCAATACCACTATTTGGTATTGAAGGCGACATCAAGCT
TGAAAG
gtaaactcatatatatgagatataataactacatcagattacatgttaatgccaacttca
gactgagctagtttttatttttgtgtctttttaggattagagtgagagttatctctattc
agttcacgttcagttaggtaaagagagctaattcatattcattctctgccctctgtcttc

Exon 11 +      78143      78202   1   Internal     60    63    Marginal
gatataataactacatcagattacatgttaatgccaacttcagactgagctagtttttat
ttttgtgtctttttaggattagagtgagagttatctctattcagttcacgttcagttagg
taaagagagctaattcatattcattctctgccctctgtcttctctccgtaacgttgttag
GTGGGATGTTGAGCACTACAGACCTCACAGTGCCAAATGGAGCTGGAAGCAGTCCAGTGG

gtgagtgaattcctactcttctgttttgtaggtatctatcctatatgagatcaaaggaat
gttgttcctgaaataaagctttctgggaaatttccttctgaagggtactttcactaatac
atcaagataatttcttaaggggagactttctctaacttccctgcttaccaaagttagact

Exon 12 +      80491      80597   0    Initial    107    47    Marginal
ccagagcatgcaataaaaaggactagcatacgttaaattgaagtcccaggaagcaaagtc
agagaaaattgggcagaagcagtatttgaagagataatcactgagaattttccaaaacta
acaacaacaaaaaagccacaaattgggaaggcctataaaactcaacgtggaatacagata
ATGCTGTGCTTTATGAGAAATTTAAACCTTTATGAACAAAAGACTGGAGATGGTGAGCTA
AACCTCCTTCTCAGGAAGTCAGAAAAGGACAGCAAATTAAACATAAA
gtaggtagaaccaaataacaaagatacaagcattgaaatagaaaatagaaaattttctat
ttcaggcatggtgaaacagatgatctcatacgtgcttttgtggtattgtaaatcagtaac
aatctttctggaaaggttttggcaagatgtttcagtggtcataaaaatacaagtattgat

Exon 13 +      92985      93172   1   Internal    188    69    Marginal
aagtattccaaaatcagaaacacttctggtcccaagcatttcggacaagggatactcaaa
cctgtagtgagttttgttataaaatttatttgcaactcagactggggaaaacttgatttg
tttgtgccaaagtattttaataactcttctcactttattgaatgatatttttccccccag
GGAATGGATTTGTAAACTCAAGAGCTTCTCCAAATTTGATTGGAGCTACTGGTGCAAATA
GCTTAGGCAAAGTCATGCCTACAAAGTCTCCCCCTCCACCAGGTGGTGGTAATCTTGGAA
TGAACAGTAGGAAACCAGATCTTCGAGTTGTCATCCCCCCTTCAAGCAAGGGCATGATGC
CTCCACTA
gtaagttgaacctttcttcaacttcattctttaaaacacatattttatacatagtcaatc
tgtagcttcctttggaattttctgtgccaccgtagaatctacacctattcctaataaata
tttccattcaaaattagtatttgaagagacaagtctatttcaaatacacaaaaatcagat

Exon 14 +      95593      95721   0   Terminal    129    62    Marginal
ccatggggtgctcagaagctcctgaaaaggtctcgctgtggtacacaactgggagagggg
aagagtagccactacactaggggcaaaaagttttgccaggatctttttgtcttctttctc
taatatgaaacaaaagctttaatctctgagaagacgaacaacaaacattatcactcttag
GGCACTGTTGAAATCCTGTTTAATGGAAAAGGCAAAATATCTCAACCAGTGGTGAAGGAA
CAGGAAGACATGCTCGGTATGGAGCGATGCCAGGAGAGTGGCAGGATGACTGAGAAGGCC
ACAGCCTGA
ggcacaacaagagaggggatgacttaaagctgagagtggagcaggcactaggggaaaacc
tggcatgcagatccccacccccagagggatatgaagcttgtggtaggtgccctgatggta
accagagcaacagtaaggctcaaacccagtccagcttctaatgaaattaactcgattctt

Exon 15 +     106464     106567   1   Internal    104    58    Marginal
actctagtttttctatttataattgtatgtgttgacccattttatttgttggagggaaca
ttggaatagagcctttaaaaacagtagctgtccatgagcataggatacttgttaattttt
tttttaaggaaagatacaaaataccttatatagctctccaaattattgaaatatttttag
AAAATGACTTCACCCTCGAAGTTCCTCAGATTGTAACACACGATGTTGTGTTGTTTCTCT
TTCAAAAAGATTACATCATTTTTGGTGAGGTCACCTTTTTCAGC
gttggaattatttcatcctgcatgatacagcctgaaccacaagggggttccctgtttact
aaaaggaatgtctgtaattgaatgtgtatataagtttacttttctatcagaaggcgctct
tttcttaaaagcaactattgccctttttccaaaacaaacgttttctgttggcttttcctc

Exon 16 +     109473     109679   0   Terminal    207    55    Marginal
ggacccttcaaattaaatatttagttattctcactagtatttttgaagttttcacatcat
cagtgcttcagaaaatgacattcatatgaaactgtgaaaaatgtcacttaaattgaaagt
gatttttaagtcaacataaataccacatcagaacacattttctcttttttgatctcacag
AATACCCAGAGGATCAGTAGTTCTCAAGCCACTCAACCTCTTGCTACCCCAGTCGTGTCT
GTGACAACCCCAAGCTTGCCTCCGCAAGGACTTGTGTACTCAGCAATGCCGACTGCCTAC
AACACTGGTGAGCCTGCTCTGGTGCCTTCCGTAGGTTTTACCGCTCTCTGTTTTGTGATC
AACGTGTGCTTCTGTGATTTTTTTTAA
gtatatttattgaaataaactatttccagttttttagatttaaattaggatgtatttttc
aatgtgctagccttgaaaaaattacaaacaaaatggatagtgtggatagtgcgatgagta
agttattccggcttctccagtgtgaactttcacttaacccctgacacaaagccacgtgga

Exon 17 +     113378     113451   1   Internal     74    62    Marginal
gctggtctcaaactcctgacctcaagtgatccgcccatcttggcctcccaaagtgctggg
attactggcatgagccagcatggctggcctcaatgtaggaacttttgcagtagctacgta
aaaaatagattccgtatggaccttccatcatatgcagagccctcttgtcttcctttgtag
ATTATTCACTGACCAGCGCTGACCTGTCAGCCCTTCAAGGCTTCAACTCGCCAGGAATGC
TGTCGCTGGGACAG
gtgtcggcctggcagcagcaccacctaggacaagcagccctcagctctcttgtgtgagta
actagaagttttccctgcatctttactcctggcctacacactctcttttcctatcagtga
cagccttttgctctgttgagtttcgtgtgaggaatcctgtaatgattccttttcaggtag

Exon 18 +     114728     114795   0    Initial     68    42    Marginal
tcctgagcatcctaaatgaatgcactaaaaatagtcctggaaaagcaagtggaaagggct
cagagcccaggcccggggaacagcctgtttgcgtcctcctctactgctctcagccagccc
ctcatttcctcatctggaaaatggggatggtgcgacttgcaccttagaggtgttgcgagg
ATGAGCGATGTTGTGCCCTGTCACAGGGCCAGAGCAGATGGGGAGCAGATGCTGAGGAAG
AAGAGGCG
gtgagcagatgaggctgctgttcctctgtctttctggtccctgcacagcattaagacact
gacattgttttgtatactttagctgcaaaagtaccaacgttgtgggtaacagaaccaagt
aacgtaagggctcaacggtactgttttctttcctcctaggaagatgggatttccttttgt

Exon 19 +     115134     115515   2   Terminal    382    70        Good
ggaagatgggatttccttttgtgccaagcactgaaggaaacgacccaaaccagtcttggg
gaactctgataagatttcagactctgggcccttttccatcaggcagtgtctctactgtat
catcccagttttgcagaggtacttgcaagccatctgacctctctcttttttttccttcag
TGCTGGAGGGCAGTTATCTCAGGGTTCCAATTTATCCATTAATACCAACCAAAACATCAG
CATCAAGTCCGAACCGATTTCACCTCCTCGGGATCGTATGACCCCATCGGGCTTCCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGCCGCCACCACCGCAGCCCCAGCCACAACC
CCCGCAGCCCCAGCCCCGACAGGAAATGGGGCGCTCCCCTGTGGACAGTCTGAGCAGCTC
TAGTAGCTCCTATGATGGCAGTGATCGGGAGGATCCACGGGGCGACTTCCATTCTCCAAT
TGTGCTTGGCCGACCCCCAAACACTGAGGACAGAGAAAGCCCTTCTGTAAAGCGAATGAG
GATGGACGCGTGGGTGACCTAA
ggcttccaagctgatgtttgtacttttgtgttactgcagtgacctgccctacatatctaa
atcggtaaataaggacatgagttaaatatatttatatgtacatacatatatatatccctt
tacatatatatgtatgtgggtgtgagtgtgtatgtgtgggtgtgtgttacatacacagaa

--------------------------------------------------------------------------------