--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (23564 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        714        772   1   Internal     59    61    Marginal
ccagtcgcagtggctcactttgtgagcctggggcaagcagatcgcttgaactctggagtt
ccagaccagcctgagcaacatagcgaggccccatctctacggagaaaaaaaaaaaaaaaa
aaaaagaaaaagaaaagaaaaaacaaagttgggctgggcttagtaattacttgatcccag
GAGGTCGAGGCTTTGTAGTGAACCTGTTCGCGCTACTGCACTCCAGCCTGGGCGACAGA
gtgagacccggtctcaaaaaaaaaaaaaaaatcaaaatttgtggaataagaaaattatgt
gtctttctccacgggattgtaaattctatgaggagcgctatatccccaagatcctagaac
attaatcagcacctagtaggtgtggaacaaacgtcttaccttaacagcgagtcaatgaac

Exon  2 +       9354       9455   0    Initial    102    58    Marginal
agtaggattgcagagtctctcctctgttgattcctgcctcccctttgatgacccccgggg
aggtatgtttgttttcttaacagcatttgaatcttcctgagacatctcataaagtggatt
tctctgtcaaaatattcttttttaagccttcaaaaacaaaaattcttactgtcttctttg
ATGATTTCTTATGTTCAGGTTCAGACAGTAACTTTAATTCCAGGAGATGGTATTGGCCCA
GAAATTTCAGCTGCAGTTATGAAGATTTTTGATGCTGCCAAA
gtaagtgggcttaaaaaatacatttaatgatgactcactgaaaagttttcttagccagtt
ggattctgtgaacttttaggatgcattgtacccatttctatgaaatttagtcaggtctgt
tgttaatctccaccgattgtcactttaacagtgtgtgtctcagtgtttgctactgccatt

Exon  3 +      11916      12078   0   Internal    163    72        Good
tggaacctgggaggcggaggttatagtgagccaagattgtgccgctgcactctagcctag
gcgacagagcgggactctatctcaaaaacgaagttgaaaaagtttgttcatcattgcagt
atgaatgccagtttcctttaagtctctccagctcactgtgctctgtgatgtggcatctag
GCACCTATTCAGTGGGAGGAGCGGAACGTCACTGCCATTCAAGGACCTGGAGGAAAGTGG
ATGATCCCTTCAGAGGCTAAAGAGTCCATGGATAAGAACAAGATGGGCTTGAAAGGTAGC
ACTGAAGTAGAGACGGGGGTTTTTACAGATTTCCGCTACAGGG
gttacttagttttgaaaatttatgcatttaaactgaataaggcctggccatctgtgaagg
taacgccattcttttatgaagtaactactcatagtaagatgttttattcatttgggacat
ttttttcccccagtaaaaaacattaaagtattactggatgatgccaaataacagtatctc

Exon  4 +      13405      13592   1   Internal    188    71        Good
gaaacgcagttaatgttccagaaagctcccgtgaggaagtgttcctccttcatttgaatc
tcaggtagagagtgaactagaggcagaacacatttcacaaggtagccgaggtgggttagt
aggtcacacgtgagaccagaattccttctagtgtcatctgggttttcttctgtataacag
GCCCTTTGAAGACCCCAATAGCAGCCGGTCACCCATCTATGAATTTACTGCTGCGCAAAA
CATTTGACCTTTACGCGAATGTCCGACCATGTGTCTCTATCGAAGGCTATAAAACCCCTT
ACACCGATGTAAATATTGTGACCATTCGAGAGAACACAGAAGGAGAATACAGTGGAATTG
AGCATGTG
gtatgttcactccagattcttttttattcctgcttggactgctttctgtgcatctgggac
cccagagacagatctgctttatctctgtgaggagttgtgggtgtttgtcttggtgctggg
tgtctggctgacagtactcaaacaaatgtaaggcatggtggttcgcgtcacaagcttggg

Exon  5 +      14058      14195   0   Terminal    138   100   Excellent
acttacctcttagggctggagttaacatgaaccccattgtcgtagcagtgtgtgtgatta
gtcatgctagctggcactgtgcaggcctgccacaaatgttactgtctactccccaccctc
tgtctcccactgcgttgctgtcacactctttccagcaaggtgggacttcctgtcttgcag
ATTGTTGATGGAGTCGTGCAGAGTATCAAGCTCATCACCGAGGGGGCGAGCAAGCGCATT
GCTGAGTTTGCCTTTGAGTATGCCCGGAACAACCACCGGAGCAACGTCACGGCGGTGCAC
AAAGCCAACATCATGTGA
gctccttgcgggggccggcaccccatcttgctttgttgtgggagagcagtgacagggctt
ccctttctcctcttcagcttgttccttgattcctaatatctttgaaaaagaactttgtaa
caatccaaagatacggcatctctcttctgtcggagtctcctcttttctcctctgtttttt

Exon  6 +      15331      15421   2   Internal     91    60    Marginal
atcctaaaacattttcagcttatattttattaactacctaagaaataattttattgtaat
tgggatcaggtagcttggcttctggaacttaaatgtcttgaacttactttacttctttga
tttgattcttttctttctgtaagacttttttttcagcagtttttatttgattaaatacag
GCGGATGTCAGATGGGCTTTTTCTACAAAAATGCAGGGAAGTTGCAGAAAGCTGTAAAGA
TATTAAATTTAATGAGATGTACCTTGATACA
gtatgtttgaatgtaagtatatattcacacttacctgctactttttatggtgaatggtgt
ctgtgtgttgtggggatgcagattttgattactaaatgcacaaatgtattccttgtagat
ggtacaagatccttcccaatttgatgttcttgttatgccaaatttgtatggagacatcct

Exon  7 +      15540      15604   0    Initial     65    79        Good
aatgcagggaagttgcagaaagctgtaaagatattaaatttaatgagatgtaccttgata
cagtatgtttgaatgtaagtatatattcacacttacctgctactttttatggtgaatggt
gtctgtgtgttgtggggatgcagattttgattactaaatgcacaaatgtattccttgtag
ATGGTACAAGATCCTTCCCAATTTGATGTTCTTGTTATGCCAAATTTGTATGGAGACATC
CTTAG
gtgagtctggctgcaacctatttattttagcctatgatttacttataaacatcctaaaat
aattatggcttaacattttcaattgagtattgtgaaatagagtatttgttgtaacatatg
aattgaattctaacagttcaggttgtgatatgaatgattacatgttgggtggcttgttcc

Exon  8 +      16816      16945   2   Internal    130    98   Excellent
gacacagtaagatgctcgaggctcatctgtattttcctaacctttgccctggaatcagcc
atttatccaaggaatgctacttccttttagtggagaatgataattaaaaactaaaatctg
ggtgctaggtgagatgttttatttttaaaaacattctttgaaatgcttttcttccgctag
TGACTTGTGTGCAGGATTGATCGGAGGTCTCGGTGTGACACCAAGTGGCAACATTGGAGC
CAATGGGGTTGCAATTTTTGAGTCGGTAAGGACCCTGACACCTGAAACAGAACTCAGGTC
AGAACAGCGT
gtgaactcaggaggagttatctgtataagtatgctttaactccagtttttcaaattgtca
aaacaaaatgatgctttttttttttctcgagacggagtctcgctctgtcacccacgctgg
agtacagtggtgcgatcttggctcactgcaacctctgcctcccaggttcaagtgattctc

Exon  9 +      17974      18189   0   Terminal    216    78        Good
tgagctatcacgcccaacccagactttatttcttcagtccatatcagatgaattgcacgc
agtagctttcagtgcatattttgtattgctgaggaaagatggttaagactccagcttccc
cagaagaggactgttagtttttgtctctcccttgatgatgctacttttcccgatgtgtag
GTTCATGGGACGGCTCCAGACATTGCAGGCAAGGACATGGCGAATCCCACAGCCCTCCTG
CTCAGTGCCGTGATGATGCTGCGCCACATGGGACTTTTTGACCATGCTGCAAGAATTGAG
GCTGCGTGTTTTGCTACAATTAAGGACGGAAAGGTAACAGGAATCTTGATTTACTTGTGC
TGGGTAAAATGCATTGCTTCCATGTGTTTTATCTGA
gtgaaagggacagtgacagataatagttctcaggcgggcccaagcatttgatgttgaaca
aggattcttaacgtgggtcccagattgaacagggtatgtgtgcacatgtgtgcattttct
gaggtgaggatctagatatttcatccaaaaaaagttaagcagcactgatgtatagacatc

--------------------------------------------------------------------------------