--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (20651 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5909       6009   0   Internal    101    71        Good
cagctactcaggaggctgaggcaggaagaattgcttgaatctgggagcagaagttgcagt
gagccgagattgcaccattgcactccagcctgggcgacagagtgagacttagtctcaaaa
aaaaaaagatgcaaaaaagtggtggcttaaatatgataggactctgtttctctctcatag
GACAGTGCAAGTGGAGGAGGTCCAGGGCTGATGGGCAGCTCTGCCATTCAATCTGTGGTT
TCCATCTCTGACTCTAAGCTGGATACTGTGGTTTCCAGAAG
gttgggggaaggaataccagggaaaggcatctgtaattgttttaactgccagacctggat
gtggcatgttatttctgcttgctgccattgatgagaactgagtcacatagctctcctagc
tgcgagggaggctggaaatgcagtcttcagctgaacggtcgtgcacccatctagacctct

Exon  2 +       6372       6496   0   Internal    125    81        Good
tactttaggagaaaactagaatgcattggcgagaaatataccagggtgagttttatgatc
tccatttcgcaaccgaggaaacttgcccagaatctcgcagtgaataaatagtagaggtgg
gatttgaactctgatcttccagttcccaaactctgtaccaggttgccccattgtgcttag
GCCTCCCAGTTCTCCATCACCAAGGGGGCTTACAGGAATCAACAGGGGAATGAATTCCTC
TTGGACAAGAAGTGGGGTTTCAGAGTTGGTAGTGTCCTGGCTGCAGTGCACAGCACAGAT
GGCAG
gtctgggccttgggatttctgtggtgtctaagggaatggtggatttggcctctcaacttt
ctttacatccattctctccagcaagagctcctaactgttctggaaacaagaatgtttcct
ccacaatcccatcactctaacaagccaatgctgtgtgtgtctgcctgcctcctttcctcc

Exon  3 +       9442       9565   0    Initial    124   100   Excellent
agcgtctggcacgtaggcggcaggtgtcccgcagtgagctgttgagcaagcgagtgagtg
gtgttggagcagaggggatgtgggccctggaagccaggcttttctaattgccttgttttc
ctccccttcccagtttgccctggggccccagcctggcccgggtcaccctggcatgaggag
ATGGGCCTGTTGCTCCTGGTCCCGTTGCTCCTGCTGCCCGGCTCCTACGGACTGCCCTTC
TACAACGGCTTCTACTACTCCAACAGCGCCAACGACCAGAACCTAGGCAACGGTCATGGC
AAAG
gtaggcgacctcctgcacccggctctttgctcccctgggtgacctagacctccttggctc
ttgctgtgatctgagggttccaggctgggacagggacagcagccctgttccagcagggcc
cttgtagtgggccagcttgcttctcagacaggggaaggggtgagttcattttcctgtgtt

Exon  4 +      14646      14785   1   Internal    140    69    Marginal
tgtttagctcatgattctgtgggtcagcattttggagtgggctccatttcttcaggtctt
gcggttgggtcttgcagatgtgcctgcccatggtgggcaggtcagctgggggctggttgc
tgtaggatggcctcagctggggcgccctgtctctgttctgtgtattctctcatcctctag
CAGGCAAGCCTGGCCATGTGCTCATGGTGGCTGGCAAAGTCCTAAAAAAAGAGTGGAAGC
AGCAAGGCCCCCTGGGACCTATGCTCAGAGCAGGCATGATGGATAACAGTCACTTCCAAG
GCATTCAGTTGGTCAAGCAA
gtggcaaggccagcacagattcaagggggtgggggaataactgtcatctcttgatggaag
gagatgcaaagtcacattgcagagcatgtggatacagggaggggtggagcatggtggcca
tttttgcaatctgagcctgtaggagccgtggatgagggtgtgcggtggcccttgcagggg

Exon  5 +      14963      15383   0   Internal    421    94   Excellent
caagtggcaaggccagcacagattcaagggggtgggggaataactgtcatctcttgatgg
aaggagatgcaaagtcacattgcagagcatgtggatacagggaggggtggagcatggtgg
ccatttttgcaatctgagcctgtaggagccgtggatgagggtgtgcggtggcccttgcag
GGGTACAGATGTGCTTCAGCAGGTCTCATCTGCACCCTGTCTCTCCCCCAAGACCTCCTT
AATGGAGTGAAGCTGGTGGTGGAGACACCCGAGGAGACCCTGTTCACCTACCAAGGGGCC
AGTGTGATCCTGCCCTGCCGCTACCGCTACGAGCCGGCCCTGGTCTCCCCGCGGCGTGTG
CGTGTCAAATGGTGGAAGCTGTCGGAGAACGGGGCCCCAGAGAAGGACGTGCTGGTGGCC
ATCGGGCTGAGGCACCGCTCCTTTGGGGACTACCAAGGCCGCGTGCACCTGCGGCAGGAC
AAAGAGCATGACGTCTCGCTGGAGATCCAGGATCTGCGGCTGGAGGACTATGGGCGTTAC
CGCTGTGAGGTCATTGACGGGCTGGAGGATGAAAGCGGTCTGGTGGAGCTGGAGCTGCGG
G
gtgagatgctaacggggactgggtgacactgggacctgagagcagaggggagaggaccag
agaaaacatccagacctctgtgctttagacatttaaaagtacttaattctcaaaacaacc
cacatggaagctactgttgtgacccccattttacaggtgagaaaactgaggcacagagag

Exon  6 +      17471      17773   1   Internal    303    98   Excellent
agtcccaggagagaggcggcaacggacaggaggtcagaggtttgctgagtttttctgagg
gatggtgtatgtgtgtgtgttgcaggcagcacatgtcccagtgaaggtgggaggagagcg
gggtgtccagccagctgggcccctggccaccccctaagctcctctttccttcccctgcag
GTGTGGTCTTTCCTTACCAGTCCCCCAACGGGCGCTACCAGTTCAACTTCCACGAGGGCC
AGCAGGTCTGTGCAGAGCAGGCTGCGGTGGTGGCCTCCTTTGAGCAGCTCTTCCGGGCCT
GGGAGGAGGGCCTGGACTGGTGCAACGCGGGCTGGCTGCAGGATGCCACGGTGCAGTACC
CCATCATGTTGCCCCGGCAGCCCTGCGGTGGCCCGGGCCTGGCACCTGGCGTGCGAAGCT
ACGGCCCCCGCCACCGCCGCCTGCACCGCTATGATGTATTCTGCTTCGCTACTGCCCTCA
AGG
gtgagtggaatagccaagcgcgggcctgtgggtttggtggccacctgggacctgtgagag
ggcagcttctggggagctctggccccctctgctggctctgctggtactgccacctggagg
ccaagagcaccagccaccctagaagcagcatctggttgagttttgagtgctttgctgctg

Exon  7 +      18484      18770   1   Terminal    287    91   Excellent
ggcaggtgggacagagctctctgggacagggtgaagattagaaagtgttctctgcagatg
cctgcagtatggtagctccctgggctcagacgggtctttggggctggcatctctgcagac
cccgctgtgctctctggctgccccctgcgctgtacggcactcacgccccctttcccccag
GGCGGGTGTACTACCTGGAGCACCCTGAGAAGCTGACGCTGACAGAGGCAAGGGAGGCCT
GCCAGGAAGATGATGCCACGATCGCCAAGGTGGGACAGCTCTTTGCCGCCTGGAAGTTCC
ATGGCCTGGACCGCTGCGACGCTGGCTGGCTGGCAGATGGTAGCGTCCGCTACCCTGTGG
TTCACCCGCATCCTAACTGTGGGCCCCCAGAGCCTGGGGTCCGAAGCTTTGGCTTCCCCG
ACCCGCAGAGCCGCTTGTACGGTGTTTACTGCTACCGCCAGCACTAG
gacctggggccctcccctgccgcattccctcactggctgtgtatttattgagtggttcgt
tttcccttgtgggttggagccattttaactgtttttatacttctcaatttaaattttctt
taaacatttttttactattttttgtaaagcaaacagaacccaatgcctccctttgctcct

--------------------------------------------------------------------------------