--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (20667 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        751        904   2   Terminal    154    79        Good
atcagcaccgactccaccgctctcggcgaggcacctccagctcccgggaatgagaaatgt
gcccgccacagcaggggcccacaggaatgaagggcgccggcgctgcgtaggcccaacagt
tccccgcgccctcgcccccggccccggcccagcccggcccttcttcccccgccttggcag
AGTGGCGTCATCAGGGGGCGAAAAACCCGACGAGCATGAGGCCCGCAGATCCCGTGTAGG
AGATGCGACTCTCGAAGTTGTCGTCCGTGAGTTCGGAGGCAGCGGCGAGGCGGGCCGCGG
CAAGAAGCAGCGCCACACCCGGGAACAGCGCTAG
gcggcggaggcgcatggcggcgaggtggggtggggacggccggaagggtcgcggctcggc
tgggactgcggaggtcgggcgcgcgaccacaaaccggctgcctgcgctggcgcgtctggc
ccaggggacctgcagccggaggtcccaacccccaaacccggctcgggccgctgtgtggca

Exon  2 +       9546       9718   1   Internal    173    66    Marginal
ttccctgtatttcacaggttgaagcaacagtgttaagaagagaaactcttaactcttaac
acagtgtgaagaaaaatggaacagtagtgggcaaaactgtggtttataagtgtgttcatt
ctccatcattcggtttccagcttccttaacttttattcctcctttgctctatcttcacag
AATTGCTGGAATCCACAAATACCAAACTATGGCCATTGAAGCTGACCTTGGAGGTGGCAG
CTTGGTTTATCTTGCTTATTTTCATCCTGGAGATCCTTCTTAAGTGGCTATCCAACTTTT
CTGTTTTCTGGAAGAGTGCCTGGAATGTCTTTGACTTTGTTGTTACCATGTTG
gtaaggatagagatcctgagggttcgtttagtgggatgaagaatgtgcctaggtgaatcg
aaagaacaagttaacatgataataggaagaaacaaaaatttacttaacttctttcttttg
attttttttccctaaaactaaacatcaatcattgcaggagttgttggtattaggagcaaa

Exon  3 +      11017      11138   0    Initial    122    90   Excellent
cctgtgaaatgttattggatgagaaggggctggggacaggtgccatggttcaaagatgac
tgggttcagcagtgcaagagagggtttggtgggggattgccaggtgagcttgactgggct
gttggtggagatcagcctagtttggcccacatctgacatgagagttatggcctctagagc
ATGACCTTCCTCTTGATGTTGCTGCTCATCTTCTTCTACATTTTTGCTGTGACTGGTGTC
TACGTCTTCTCAGAGTACACCCGTTCACCTCGTCAGGACCTGGAGTACCATGTGTTCTTC
TC
gtaagcagagctggggacagctgggtgaggggagaaaatttggctaagagaccaggaagc
ttgtccaaagtatagtaatataaaaagtgcagtctattccaagaaactgaaatagaacac
aatagggagagggaaagagaaagcaaaagaatagtgaatggtattagctctgatcttgag

Exon  4 +      13823      14001   2   Internal    179   100   Excellent
acaacaaaaaaaaacttcaaactatagaatgattagctaaaaactgagtatggtagaaaa
ggagccaaaatcagaacaaactacaaagaaatgctttatgtttctttaaaagtaagaatg
gtaccatttttgaaaggtttaggtctctgcttctgtctattcacatgtctttttctttag
GGACCTCCCGAATTCCCTGGTAACAGTGTTCATTCTCTTCACCTTGGATCATTGGTATGC
ACTGCTTCAGGACGTCTGGAAGGTGCCTGAAGTCAGTCGCATCTTCAGCAGCATCTATTT
CATCCTTTGGTTGTTGCTTGGCTCCATTATCTTTCGAAGTATCATAGTAGCCATGATGG
gtaagcatagaggaggtgaaacttgtttgggaagtgtggttgggaaaaagttattctgaa
agctgggattggtggcttatgggtataaagaacctagtgtagcaggaaggcttgggttct
ggattggatatttcacttggattctccccacccaagccctcttcccaagtctagtcatta

Exon  5 +      14972      15118   0     Single    147    55    Marginal
tattgtagtaggttgactagtggcacccgaaataatatgtccatgtctttgctccctgga
acctgtgaatgtgaccttatttggaaaaaaaaaaagatcctaagttaaggatcttgagat
gagatcatcctagattatccaggtaggtcctaaatccaatggcaagggtccttataaaag
ATGAAAGAGGAGAAGACACAGAGAATAGGAGAAGGCGATGTGAAGACGGAGATAGAGGTT
GGGGCTAATGCCACCGCAAGCCAAGGGAAGCTGAGGAATGCCAGGCAGCTGCCAGAAGGT
AGAAGAGGCAAGGAACTTCTCCCCTAA
agcctccagagggaatatggccctgccaacaccttcatttcagactctagcctctagaat
tgtgacggaatatatttctgtcattttaagctaccaagtttatagtaatttgttatggca
gccacaggacactaatacaaataccttccatgaaacagatatgattctagaccccaagtg

Exon  6 +      17679      17843   1   Internal    165   100   Excellent
gtgtggctgtggccctctttgctcgttgtaaaaagtggtttcttactgatgcaccctttc
cctccttgcttcctgttacctctttccaccccacctttccacccacaccataggatttac
cagctcttacccaacttttacaaatctagacgtgcttttctgaagcattcctccctgcag
GTCGTTTGGACTGGGAGACTCTTGTGCACGAAAATCTGCCCGGGCTAATGGAAATGGATC
AGGATGACCGTGTTTGGCCCAGAGACTCACTCTTCCGATATTTTGAGTTGCTAGAAAAGC
TTCAGTATAACCTAGAGGAACGTAAGAAGTTACAAGAGTTTGCAG
gtatggagttagggcagtcatggggaccatgggaatatatatatagcgtttatagctgtg
gagaaggaggagggtgtccactattctggcatctcagcttctcaatttctgcctacaact
aaaataggcagaaactaaaattcttggtttggtatgtcacattctgggaatgtgtcccac

Exon  7 +      19310      19341   1   Terminal     32    60    Marginal
ttctttaatcctaataaaacttgtctatggcaaagagtacacagaatcatatggcttaat
ttaaagattagtaaagacttgtgagggaacctagaacccagaaaagcaaggtcttcacca
aacatttatatatgtagaatattcttagctctccagcctcacaatctgtttcctttgcag
TGCAGGCACTGATGAACTTGGAAGACAAGTAA
agcaatggatggcttcaatatccttgggcccagcaaaagataatgaagggaattgttgga
aatagagaattgaaaatataaacattcagatagaacaatgtctgttcattaaaattaaaa
agtataagtgtctaggccaggcgtggtgaaaccctgtctctactaaaaatacaaaaaaat

--------------------------------------------------------------------------------