--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (175275 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (26 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1257       1523   0    Initial    267    51    Marginal
ccgccccgccccgccccgctccgctgcggccggcctcgatccctagccccgcaccccgcg
cctcgctgctaccgggcgcctttcgctcgcggctcctccgtgcggcccgcttccggtggg
gccagggcgtctccgccgcagctcggctcccgcgcgctcagcaccgccagcggcggccag
ATGCAGGCGGAGCGAGGAGCTCGGGGAGGCCGTGGGCGGCGGCCAGGCCGCGGCCGGCCT
GGCGGAGATCGCCACAGCGAGCGGCCCGGAGCCGCAGCGGCGGTAGCCAGAGGCGGCGGC
GGAGGCGGCGGCGGGGACGGAGGCGGACGCCGGGGCCGTGGCCGTGGCCGGGGCTTCCGC
GGCGCTCGCGGAGGCCGAGGAGGAGGAGGCGCCCCGCGAGGCAGCCGCCGGGAGCCGGGA
GGCTGGGGCGCAGGGGCCAGCGCGCCG
gtaagaggcgacggctggtggggctgggaccgcgtgtaactggggcaagtggggccgagg
ccgccagtcaagagccgcaagagagcgtgccaggcgcgcgccagacgggcggcggcgccg
gcgcctgcgcgggacgggcggatggtggcgcgggggcgcgcctggtggcgggggcgcgcc

Exon  2 +       8344       8483   0    Initial    140    63    Marginal
tgacacatagtaatttctatttgatagaagctactgactaacttattacggcactggatt
agttctctttgattttttttttcttttgttagaagccctgtgtgtgtgtgtgtgtgcgtg
tgcgcgcgtatgtgtgtgttgaggtgccagaaataagtactttaatactttttctcttgg
ATGGAAATAATTAACAGCTTTGTTAGTCTGAAAATTTTCTACAAAGGTGTCATGGGGCAG
TGCATGGATAATGGTTATGGAGAATATTTCACTTTTGAGTGGGTTTTGTCAGAGGATGCT
GAAAAGAAATACAAACTGAT
gtgtgtgttttatcttgatgctgctaggatgctgttgttataatctgaccaacctgattt
tgtaagccttaaattgcttaaaaggcaattcctgtgaagaacaacactgccaaggatgct
gtttcctaccgcccatatcacatcattggtgtgtgtgcaaacagcacaacaatccaaaaa

Exon  3 +      16806      16943   2   Internal    138    76        Good
ggcttacagagtaggggcaagaataggacagtgttccagaggtcagagagtttttttatt
ttcttccatcttttgttagagtctgaaataaatggtgacacctaagaggaggttaagaaa
ttgtgcactgaatctcaggttttgcaagaatgaatgaccaggctttctctaccctgacag
CATCATCAAGAGGAAGGTGAGAGGTGGGCTGCGCCTGAGCTCTGGTGTGTATCGGCTATC
ATTATGTGATGTGGCCAAGAGAGATGCTGCCGCAACAACTGTTACTAAGATTACTAGGGA
GGACTCGGCCAAGATGAG
gttagcccaccacagcctatttcttttgctgatagcaaccaaactcagtgggcagattac
ctgaggactcagaaaagtaaagaaaagctggcagattgtgaagtgaaagcctggagtagc
aacctgagtgggggatgagaggggtaagtttctcattgttcttttcctttttttttttct

Exon  4 +      16979      17070   2   Internal     92    52    Marginal
ctgacagcatcatcaagaggaaggtgagaggtgggctgcgcctgagctctggtgtgtatc
ggctatcattatgtgatgtggccaagagagatgctgccgcaacaactgttactaagatta
ctagggaggactcggccaagatgaggttagcccaccacagcctatttcttttgctgatag
CAACCAAACTCAGTGGGCAGATTACCTGAGGACTCAGAAAAGTAAAGAAAAGCTGGCAGA
TTGTGAAGTGAAAGCCTGGAGTAGCAACCTGA
gtgggggatgagaggggtaagtttctcattgttcttttcctttttttttttctgagaccg
agtctcgctctgttgccaggctggagcgcagtggcgcgatctcagttcactgcagcctct
gcctgggttcaagcagttctgcctcagcctcctgagtagctgggactacaggcgcacacc

Exon  5 +      34452      34533   2   Terminal     82    76        Good
ccaaggctattttctgtagaatgttcctggtatttgttatttacatagcagattctatta
tatctctttaatctgccagcatcttttggttctgagaaacttgcaggaatgctctagttt
tcaggcagtctttgcagtccctagatcataatgtagaacgccatctttttgttttgacag
GGAGGCTTATGATGATATTTGTGGGCTGAACGTGATCTTGAAAGGCCAATTAGTCTATTT
CATGAAAGTGTATGAAAGTTGA
ttcaggtgaggattattgactagtgttaaatttgttaagtgaatggttggggaactagaa
atttacagtggatcaaataacactgcacaaacaatttcctcgatgaaagagggaagacat
atctgtacagtgggtgagtggatcagacttcattatccaaaccctgtggtccatcttagt

Exon  6 +      37094      37297   0   Internal    204   100   Excellent
ttcaccctaaaagaacactctggtatagtgtgattctcttaaaataatatttaatatctt
cagacagcttggtctattgctttttattgttatgtccatgtacttttttgttttactggg
aagtctactaaggtcaggatttccactgcttacttattgatttgtctctaatgattgcag
GTTGAAGATGACAGCGATGCAGAGACCTATGGAGAAGAGAATGATGAACAGGGAAATTAT
TCTAAAAGAAAGATTGTCTCTAACTGGGATCGATATCAAGATATTGAAAAAGAGGTCAAT
AATGAAAGTGGAGAGTCACAGAGGGGAACAGATTTCAGTGTCCTCCTTAGCTCTGCAGGT
ATGAATTCCAGTTGCATGCATACT
gtttagtgctctgaaagttgcacagacattttatatatgtttttaaattctacttttata
actagcaatttatcctttgttctttggatttttaattcaagtaaaggacagtgtttctaa
tggcttgtaagggaaaaaaatgagtttaagtggaagtaagggtttccatgtaccgatgta

Exon  7 +      40867      40921   0    Initial     55    70        Good
gcaaatgctgggtatgagagaaaaagatacgtaaggatgacactaggttttgggtctgaa
cagtgagaagaagggagttgcccttaactgaggtgtgtaagttataggaggtaccagtgt
tgcatgtattaaaagtgagatgtcactttgatacctgttgcagtcagaattccttaataa
ATGGCTGGCACACTCAATATAATTGAACACTTTGACAAAGGAATCATTTACAAAG
gtatgtgtagagtctaatgaaagcactgaggtagtgctgtgttgagagggcaagtagcgg
cagagatgttaccaccctagttactggaaatttgaagggagtcatagagagttggccttg
ggagaatgaatcaccttcggtgaggggactcagccagtgaagatgaccccactctgagag

Exon  8 +      45631      45790   0    Initial    160    63    Marginal
aatgttatttggaagatagacctttatctaagagtacacctttatctaagagtagagaat
atagaacttcaagagtagagaatatagcttaacatatattctctaagtagatttccattg
taacagtgaatttttgaagacttgtaattaaaaagtgaatttctatttcacacacactgt
ATGTATATGTCGATGCTCACTTTGGAAGATAGTTTGCCATTTTCTGATAAAACTGAAGAT
CTAGCACTTTCACCCTTAAAGGATACTCTAGAGCAGAGGTCCCCAACCTTTTTGGCACCA
GGGACCGGTTTTGTGGAAGACAATTTTTCCACAGACCAGG
gtgaggatgacggtttcaggatgattcaagcgtgttacatttattatgtgctttatttct
attattattacattgtgatatgtagtgaaataattatacaactcaccataatgtagactc
aatgggagtcctaagcttgttttcttgcaactggatggtcccatctgggaatgatgggag

Exon  9 +      57981      58097   0   Internal    117    64    Marginal
tggcctcttaaccatatgttattgctttgctccagaaaatattttagtagtattatcaga
aatacttccatttatttttttccttttttaatttttatttttggcagagcatagcatttg
gtaattcttggggtcattactagggtttggattgggatgggagagggtgtgatcttatag
GAATTTGAAATTGAGAAGGCAGCACTGCTGAAAAATGCATTAGGGCCAACCTCTGAATTA
GATTGGCTTAATTTGTTGGGGGCAGAGCTGCAGATGCAGCTCTACATCTGCAGAGAT
gtaggtgttaacaaatgtgttaaaataactcttatttagtgctgggtgtggtggttcatg
cctgtaatcccagcactttgggaggctgaggcgggtggatcatctgaggtcaggagttca
agaccagcctggccagtgtggtgaaatcttgtctctactaataaaaaaaaaaagaaaaaa

Exon 10 +      68419      68499   0   Terminal     81    77        Good
ctctaattcagttcctgtcatgcatctctttagtgtcttggtgatatgacttgaaataat
agtgcttacatctctcttttagctagttcacactgaaagcatataatcatctgtttgata
tcagagccacttcccagtcacagattgtgatgtcacaaaccaaagattgttctctctcag
CAGGAAGAAGCTGGAGAGGAGATGATCTTCATGGTGAACTACATCCTTATTCAAATTTGG
TCACTTCATAAGGAAAATTAA
ccataataaggaacaaatatattggctagttgaaatgcccagttgaattaagcttgaaac
acggtgccattataatggaatgaaaaaaattccttatgaaaacttaaagttataataatg
aagatataagtaaatatatatttaatgcatttaaaaatattatgcaatgtccctttaagt

Exon 11 +      71903      72034   0   Terminal    132    78        Good
ctgttttttgaatagtgaggtaaaaatccagaaggaagtacggctttatcatgtctctgg
acggtgagcgtacttggcatgaatgaagagctgataggagctattcaaaccagacagcaa
actgatgggatgacgctgccatacataaaaaactcattaattacttcccctgctggacag
CAGTATATCCTGAAAGGAAGAAAGAAAGGAGCAGATGATGATATTCGTTTTGATAGGTGT
TCTCTGTTTGAACAGCTTGTCATTGAGAAGAGAATCCAGGAAAAGCTGCAGCTTCAGAGT
GTGATCAGGTAG
aatgggcaagagttatttgacagacagttaagtgacgtattttgggaggaaaaagagggc
ttagcatggaggtagctggaataaggttccaaaatgcttttgaaaatgttcattttttcc
tgttagtctttttggctagaagcttttttttttttttttttttttttttaagctttgcta

Exon 12 +      83856      84044   0    Initial    189    75        Good
aggccaaaagataaatgattatgtgtgtgtgggcaggggagataggatggtgactcatta
cagagaactagtttccaatatatatgatgtgttttaacaaccctattaaaactgggcaaa
ggctatgagcagactgttcacagaaaatgaaatgcaaatggctcttaaacatgtgaaaag
ATGCTCAATGCACTCATAGGAGAGATGCAAATTAATTACACTGAAATACATATTTTCAGT
TATCAGATTGACAGATCAGAAAGTTTGATTAGACTTTGCACTGGCAAGAGTGAGGATGCG
CAGTGTTGGAGAAGAAGGGCATTTCAAGTTGAGGGGAATTGGAGGAGCGGGGAGATGGAA
ATGGGAAAG
gtagggccagcacattagagcaggacaggtgagctaatgtaggggcaggcgtgttgactt
tagcaaggagcgacagctggcgctctagtgtcatgggagaagcagggaaactagatagct
acacgcaataactacaaatgctggtcaccgcggaggcagacggccctacagataacagcc

Exon 13 +     100197     100335   1   Internal    139    82        Good
cttaatgattttttaagattgttagaaggaaactgagctgcagacttacattacttgttc
agtccaaattacactttccccatctgtttaacaaaaaatgcgtcatagcttaggctgcta
taacaaaatacttaaactgggtggcttaaatgacaaaatttatttctcataattctgcag
GCTGGGAGGTTCAAGATGAAGGCACCGGCAGATTCCTCCTGCTGAGGGCCTGCTTCATGG
TTCCTCGAGAGTATCTTTTTGCTCTGTCTTTACCTGGTAGAGAAAGGAAGCAAGCTCTCT
CAGAACTAGTAGAAGGAAT
gtaaatatacttaacactactgaactgtaaacttaaaaatggttgagatggtaaatttaa
cgttgtatgttttctaccacaatagaaaaagtaaaaagagggatattaatttcattcatg
agggcttctccctcatgacttcttctaatcctaactacttcccgatggccccatctccta

Exon 14 +     105656     105782   1   Internal    127    50    Marginal
cacaattggaaagtgatagagctcaggtttggagacatatctacctgattctgtagccca
tatacttttcactaagttacttccattctgagagagcgtaaccaggatacaaggtaaata
catgatactcagattgtttctgtaatgctttgatttcacgacgtgaagagttaaacatag
TCCTCATCTACCACTTAGTCATCCTTCCTAGCAAGGACATTAGAGTGCTGCAGAGACTCC
ACTTCACAGAGTTTGCAGTGGAGGAAACTAGCCCTTATGTTTGTGTGGCTCAGGATAGCT
GTCCAAG
gtgagatagatcagaataaaaacacaaaacaaatgagaaattaacttggaaatagataac
actttgtgtgatatttcccctcctcccttgcaaattcttttctcttcttttggttgctag
aagaattgcttggtctctaattgctgaagattttgttttttgagactaggtttcattgtg

Exon 15 +     107842     107982   0   Terminal    141    66    Marginal
tgttggctaggctggtcttgaactcctgacctcatgatccctccacctcagccttccaaa
gtgctgggattacaggcgtgagccaccgcgcccagcccagacctacaatttaaaagtaac
gctggcttaaggagaccatttcttattcttcttcataactgtgtattattcttgttacag
TTTAACTTCCTCATAGAGTTAATCTTGCAAAAACGTGTACCTAGTAATGTCAGTGTACAT
AGAGTTGTCCTGGGAACTATGTCTGTCTTCATGGCACTGTCCACGGAGTACACACTTAGA
ACTGACAAGATCACTGTATGA
cttgttaacatgtgaatcactggtggacatggagactcttgctgttttgttgatttggaa
atggtagttctgaacttgccaaattgggtatatgttatttagtataagttacaaaaaaag
accaaaggttttcagaatgtgtgtttattcttcaaggttctgctcatttcttttagcatt

Exon 16 +     118442     118476   0   Internal     35    51    Marginal
gtttgtcaagagatctgacactagtatgtttacaaggagaattgaccaggttaactacct
cctttctttatttactaggagtgtttccatagacccctccccaccctccgctccctgctc
ttaaggagaaatgaactgtaggtttgctgctaaccattttttcccaatctctccctccag
CCTGAGCAGAGACAAGACAATAATAATATAGCCAG
gtcagttagcatgtgtgctgagttttcttctgttctcttttgttaaagtttgagatttgt
ggatgtgcttacattttgagtatgattcttgtctcttcagaataggaaaggaagtgtcca
aatgagcctttctgatgctcaaaccctcatgatgtcattgttttctaaatattcttgttg

Exon 17 +     131581     131765   0    Initial    185    46    Marginal
caccccaggtgactgctcctgtctttgctggtttgtcttttctcctgcagacttctgtat
gaatcaagccccagccctcttgtagtttctccattaactgaattatttgtctttttaaaa
tattgatttatacacaatagcaaagaagtaaaaacaacctaagtgtttattcatggataa
ATGAATAAATGTGATACAGTGGATTATTACTCAGACTTCAGAAAGGAAATTCGGAAACAT
GCGACAACAAGGATGAACCTTGCTGAGACAAATAAGCCAGTCAGAAAAAAAAGAAAAATA
CTGTATGATTCTACTTATATGAGTCACCCAGAATGGTCAGATTCACAGAGACAGAAAATA
GAATG
gtagttgccagggttcggggtgagttctcatgggaataacctatttgcccatttgcaatt
atagagtgattttatactctataaatgtaccaacagtgacatgggttaatactcataacc
agctcaagatgtgaacaaaaaagcaggaatcttttattccaggtaacaataatgcttgta

Exon 18 +     137129     137243   0   Internal    115    62    Marginal
ctgactgaagacctgctgttgctgcacacatgagcactgcaatttgtgccatccatgtca
gtgttactgtcactgggcagtggacactgctactgcctctgtccttttataaactgtttg
tagttgccaccacataatactaagaatggattctgcataatccctcattctcatccctag
TTTTTGATTCAAATACTGCGGGTGAGTATTTATGATCAATGTGGCCTCATTTACGTGCCG
ATGTCTAGAGCAAGAGATGCTGGAAAAGAAGTATCTAGAATTTTCTGCTTTGATA
gtaggagaggggctctgttttataaggtgagggatgctaaggattaggaaggggattcag
atcctggcggccaaaagaatgacaagtggctccattagatggcatttgctttagcagttg
tgaagggtggagggtaaattgatcatcaaactataggagagactgctaaagataaacaca

Exon 19 +     147052     147299   1   Terminal    248    65    Marginal
ctgcaaatactactttctgatataagcaaggctggtgtttgtatgaatttcttcctacat
gttaaaatttctgtggagatacagccaatatcatactgaatgggcaaaaactggaagcat
tccctttgaaaactggcacaagacaaggatgccctctgtcaccactcctattcaacatag
TGTTGGAAGTTCTGGCTGGTGTAATCAGGCAGGAGAAAGAAATAAAGGGTATTCAGTTAG
GAAAAGAAGAAGTCAAATTGTCCCTGTTTGCAGATGACATGATCGTATATTTAGAAAACC
CCATTGTCTCAGCCCAAAATCTCCTTAAGCTGATGAGCAACTTCAGCAAAGTCTCAGGAT
ACAAAATCAATGTGCAGAAATCACAGGCATTCCTATATACCAATAACAGACAGAGAGCCA
AATCATGA
gtgaactcccattcacaattgctacaaagagaataaaatacctaggaatccaaattacaa
gggatgtgaaggacctcttcaaggagaactacaaaccactgctcaacaaactaaaagagg
acacaaacaaatggaggaacgttccatgcccacgggtaggaagaatcagtattgtgaaaa

Exon 20 +     147905     148200   1   Terminal    296    46    Marginal
aatggaacagaacaaagccctcagaaataacaccacacatctacaaccatctgatctttg
acaaacctgacgaaaacaagcaatggggaaaggattccctatttaataaatggtgctggt
aaaactggctagccatatgtagaaagctgaaactggatcccttccttacactttatacag
AAATTAATTCACGATGGATTAAAGACTTAACTGTTAGACCTAAAACCATAAAAACCCTAG
AAGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGGCAAGGACTTCATGGCTAAAA
TGCCAAAAGCAATGGCAACAAAAGCCAAAATAGATGAATGGGATCTAATTAAACCAAAGA
GCTTCTGCACAGCAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAGAATCGGAGA
AAATTTTTGCAATCTACCCATCTGACAAAGGGCTAATATCCAGAATCTACAAATAA
ctcaaacaaatttacaagaaaaaaacaaccccatcaaaaagtgggcaaaggatatgaaca
gacacttctcgaaagaagacatttatgcagccaacagacacacgaaaaaatgctcatcat
cactggtcatcagagaaatgcaaatcaaaaccacaatgagataccatctcatgacagtta

Exon 21 +     148765     148911   0    Initial    147    67    Marginal
cattctactataaagacacatgcacacctatttttattgtggcactgttcacaatagcaa
agacttggaaccaacccaaatgtccatcattgatagactggattgagaaaatgtggcaca
tatacaccatggaatactatgcagccataaaaaggatgagttcatgttctttgcagggac
ATGAATGAAGCTGGAAACCATCATTCTCAGCAGACTATCACAGAAAACCAAACACCACAT
GTTCTTATTCACAGGTGGGAACTGAACAATGAGAACACTTGGACACAGACAGGGAGGGGA
ACATCATACACCAGGGCCCGTCAGGGG
gtgggggactgggggagggatagcattaggagaaatacctaatgtaaatgacgagttaat
gggtgcaacaaaccaacatggcacatgtatacctatatatcaaacctgcacgttgtgcac
atgtgccctagaacttaaagtataataaaaacaaaccattaaaaaatagttaatacaata

Exon 22 +     164308     164378   1   Internal     71   100   Excellent
gtcatctgtgtgttttgtaattttggaaatggagttggaggtatgttccagttttatcct
tgcctctccctttgagtttgagcacttcagaaatggcacttttgctctagcagggaaatt
tagagaactgagagtttccgttggcttttgcataaatttttttttttttcctattcctag
GGGACTCATTCTCACAGTTCCGGTTTGCTGAGGAGAAAGAATGGGATAGTGAAGCTTCTT
GTCCAAAACAG
gtaagataagagttgtgttaagtgtggactggctcttcttcaaggctgaaggctaacacc
ttttacgttcttgagatagagtcttcatgtagaaaagagtagtaattcttacagtgtacc
ctcagctaaacttttcagaaaattttcagggggctgaaattccacaggtccttgaagcta

Exon 23 +     168190     168301   1   Internal    112    51    Marginal
tcttatgattcctggccagagaggaagcttcaggcttgcagattctcagcacacagacag
ggtcctgtgcacactgatggcagagaagtgggacagaaaggctttgtcctacagtcagga
ctggctcccctctccccagcactggagtgtctcctttctctttacaccccacccccatag
CATCCTTAGTGGGTGTTGTCTGCTCCTGTCTGCAGCCAGATGTCGTAGGCCAGGCCCTCT
ACTTCAACTGCCAAGTGGCTGCCAGGGTTGACCAGGCTGACATGGGAGCTGG
gttacccaggcaaaaataatgcaccgaatactttaaaacatgtacaaaatgctgatttat
tattattccaattaaacctatttttaaaattcacagtttagtattaaaagcaattcactg
cagctaactttatatctaaggccttcttcagctttagccctttatggggcaaactggtga

Exon 24 +     169273     169368   0   Internal     96   100   Excellent
gctttggttttactgatcataatgtggagatgcagaaactctaacacataagtgtgatgt
atggtgtgacttattcctagccaaatgtaactccagtggattatttacagtttcttcttt
tatttccaaaaggtcataatcatcacctgatattttattttcttttatatatatatatag
AATTCAGCATTTTATGTGGATAGTGAGTTATTGGTTCGAGCCCTTCAAGAGCTGCCTCTC
TGCCTCCGACTCAACGTTGCTGCCGAACTGGTCCAG
gtaaaaatcccgaagccctcttgaagcgggtggattagggcaggaggagaaaaagagggg
aacacttccctcagcaggatgtctcagtgtcagcttccctttataaaagtgagggtttca
tatcaaggtagcattttgtaaagtttaaaggagaatccaaaaattttttgaagttacttt

Exon 25 +     172664     172808   0   Internal    145    80        Good
aagagaactgatgatggcaagggattagggatgcagttaaaggggcccttggggcctgga
ggaagggggcccatctttgagctgaaatctgtggctgctggctgccctgtgttgctgggc
aaagacaacccaagcccgggtccttcaagggattctcagaaacccacttccccactgcag
TCAGCAGGAGACCATTTGGAAGAAGAACTAGATCTGTTGCTTAATTTAGATGCACCTATA
AAAGAGGGAGATAACATCTTACCAGATCAGACGTCTCAGGACCTGAAATCCAAGGAAGAT
GGGGAGGTGGTCCAAGAGGAAGAAG
gtatggctttcattttattccccgtgaatcttgattctggtgttttttcaagaacagccc
cgcccgcatcacatccgcacacatccctctgggtgtctgacattgatccagtgttgtcca
ctgacatctatttctgtgctcacgtctctgcttccccctgagctgacctttctgacaacc

Exon 26 +     173575     173690   1   Terminal    116    90   Excellent
cagaataaagagcaaatcctctacccagctttatttgtttagatattactgtatcatctt
agggagtaagaataatgagaatgtttccccttgttgtaaggaaagtaataaattgggctg
aattataccttcaattttaggactcatctgagggtgttaacattgttttttttcccccag
TTTGTGCAAAACCATCTGTGACTGAAGAAAAAAACATGGAACCTGAGCAACCAAGTACCT
CCAAAAATGTTACCGAGGAAGAGCTGGAAGACTGGTTGGACAGCATGATTTCCTAA
aaaggggaaaaaaagtgcctgaagcaaatcttggttgccttctaacggcaggtgggcata
aggctgtccttcaggaccagccagtttacaagcatgtctcaagctagtgtgttccattat
gctcacagcagtaaatgcctacctctgtgtttgacatctgaaagaatacattgaagcagc

--------------------------------------------------------------------------------