--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (53043 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2899       3030   0    Initial    132    61    Marginal
ttccactttcttttttccaccttccacctccttagagacgctcttctggctcttccgtga
cgcattacaacagccatccaggccggtccagttacgctgcattccttcctccttcccatt
tcggcggacctgcatccagctagagactagcagattgaatcgatattcattaagttagga
ATGGTTGGTGGTCCTAAGAGCCTCAGCAACCGAGAGGAGTCTTGTTATTTAAAAAACAAC
GATACTGGGCGTGGTCGTGGGCCTGTAGTCCCAGCTGCTCAAGCTAGTGGATCTCTTGAG
TCCAAGGCCAAT
gtgagcaacatagcaagacccagtctcaaaaaataaatacataataataataaaaaaccc
tcgttcacctaaacagatctataatttatagaatgtaaagcagcaatattcaggcaatat
taaggaagatttttggtaagactggggcagcagaggtgcccttgatgggcaagggccagg

Exon  2 +       5895       6038   0   Internal    144    49    Marginal
tgctgacattagacttttttctgtaggcggccaggccctgttgaaaatacaatatgtggg
ccataaaacactgaaattgagttgcagacttgaaggcctggatttcccaaccctgaaagt
gcttcatgccaagtgacatcattcttcctgccggtctctttccacccactccaaccccag
ATCAGGATACCAGCAGAGAGAGGCTGTGAGAGCATGAAGCTGCAACAAGTCAGTAGGGAG
CAAACAAATATTGATTCAGATCAGGCCACAGAAGAGACAAGCTGGAGCAAGTGCTGTGTG
TCCCTCCTGCTCAGTTTGATCGAG
gtcactgggccgaattccaggaattctggggaatgagttggccctgtgactcagtcatta
atcaagaccataaaaccaaggagaagaatatctgctttcaaaaaggttctgataaataaa
gatgcagtaggtgggtggaggatggagtacagtgggaacccctctcctcacccagtacat

Exon  3 +       9250       9351   0     Single    102    51    Marginal
gttttcaagttgatttagcacctgcattatgtaaagataatctgaaatctgtagggggac
tgggactatgtagggaagatgaggtcaaccatatactttctactgctttgaattgtacct
atgcattcaccatttgaatacttggcacgtgtagggcacttaaaacattctgccgaatgg
ATGAATGAAGTGGTATCAAAAAGTGCCCTGGCAGTGAAAGGCAAGATAGAGTTCTGTAGA
GTAGGGGTCGTGGTGACCCTGTTGGAGCAGATACTGAAGTAG
tggtgagtgcggagaggcaagtcacattttggccctagtcaactgtagctgaggagtaaa
cagagggaactgtttactgtttacaggattctgatgctcatctttgaaggctgggctctg
ctggaggactgattttgaatgatgtcaaatgattttgacaagattaaatggggagattta

Exon  4 +       9438       9483   2   Terminal     46    49    Marginal
agtggtatcaaaaagtgccctggcagtgaaaggcaagatagagttctgtagagtaggggt
cgtggtgaccctgttggagcagatactgaagtagtggtgagtgcggagaggcaagtcaca
ttttggccctagtcaactgtagctgaggagtaaacagagggaactgtttactgtttacag
GATTCTGATGCTCATCTTTGAAGGCTGGGCTCTGCTGGAGGACTGA
ttttgaatgatgtcaaatgattttgacaagattaaatggggagatttagttggtggtggc
atgcaggactgatttgatgaaagagcagcacagttatgaatggtgaaaccgaaaggaaga
tttgtggggcttttaacagtctcctcaaggtgttgtggctgtgggagaagaattaacatg

Exon  5 +      16740      16839   0   Internal    100   100   Excellent
ttagaaaaaatgaaattgcttgcgtgaagtgtgatggtgtgttaatacctacctagttac
ctagtatgagaatgatctgaattgttaaaagaaacaataggaaaacatattaggcattgt
tatttcaacaagaggattttaaatgtgtgtcatttgagtatgtttatcttttaacctcag
CACTCTACACCCCCAAGTGCATATGGGTCTGTCAAAGCCTATACTAACTTTGATGCTGAG
CGGGATGCTTTGAACATTGAAACAGCCATCAAGACCAAAG
gtaggtgatacatttgtcctcttcttgtcagggtcttactgagacatttttggttgtctc
tttattctccctcaaatcgccatacgttggcgatttgaaattgtcatcgagctttaatgg
agtagatccagacctagctcaacccatgcctcctttccttccttccctccttcctttctt

Exon  6 +      25852      25959   1   Internal    108    99   Excellent
acagcaggggttccgggccagccagcaccctggctgaaggtgcttttgggtagtcctatg
gctagaggggagcttttctctccctaaaaatctctctcactagatggatgactggctggc
ctaacaggcttgtttggaaggacttcctccctttgctgagttattcatgtctctcctcag
AAGAGAGTCTTCTAGCTCTTTCTGCTGAAGAAAACCTCAACTGGGTTATCCCTTTAGTGG
CCATGCATTATTACCAGGTGGCAAATCATTATCTACAGATTACCAAAT
gtaagtgcatttgtatgtaaaaatttcagcccagttctctacacgtgttgacacattatt
gtaccatatcctttgtaggagctagatggtggagtgtggtatgaaaaagtatcaaagtat
aattttaaaaaggtacaaacttgactcataggataaacatatactaaacttttaatgcac

Exon  7 +      34658      34791   1   Terminal    134   100   Excellent
agtgtacacattgggtagaggatgctgacgaaagagatagaacaaatcttggtgtctggg
tatttcagtttggaaaacagtatataaatttcagtttgaaaaagtctgcttgacaccttc
tatgtaagcccaaaatactagagtatactgagtaacgattaacaacttgtatttccatag
GTGTGGATGAGGTCACCATTGTCAACATTTTGACCAACCGCAGCAATGCACAGAGACAGG
ATATTGCCTTCGCCTACCAGAGAAGGACCAAAAAGGTACAGGCAATTCCAGGGATGGAGG
GCATTTCTTGTTGA
atttttgtttcctcagacattgctttttcttttcatgaattgtggctctcatgcgcaaaa
gacttgtgggacccttggatatctaagattttcttcttaaatccttgtaagagtcactgc
acatgtgtgtgtgcgtgtgtgcacgcgcgcgtgcacctcaggtcatcaggcattaggttc

Exon  8 +      36794      36875   0    Initial     82    72        Good
caggtgatgagcttgaagaacctaggcccggctggcagagtggagaggagctgggagaga
cagctgcttttacgactctttcatgttctagcagacgccagatgcgaggcttctccttac
agggaagggttatgtttgatttatcatacatttctggagtttttgtttagtttttgttaa
ATGCAAAGCTCTGTGCTGGACATTGTGAGAAACAGGAAGTTGAACGCCCATAAGGAGTTT
AGAATAGAAGTGGAAGAAGTCA
gtaggtgcccaaatgctatttgaggtttgaatagagaatgggtagaggggagtgtcaagg
gtaggctaagtttggagttacctaacctcaaagttccaaactgggagactggtgttataa
ttgggagctactgcttttacagtcccctcctaagtgccgtgtgttcccgggacattggga

Exon  9 +      38140      38240   1   Internal    101    60    Marginal
gatgtgggtctgttgaagggaatgcagttgagggcgtttgacccaagactccggagtggt
caaagactcacaacctgcttcacaaaaagatccctcttacttttgttttactcactagtt
ttaaagtaaaataaatattttccttatgattgcctgttatcttgaaggaacttgcatcag
CACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATTGAAGACAC
CTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCATGAAG
gtaaatgcatgtgagatgtcatctctgtcaaatctgctattaattttgtgaattacagct
ttctgagtgtaatttggtgattttcagttttgttgaattctcatttggaaccatttttta
aaaatgaactgaagttatatgtctcaggatttgtaccaaaaatatttcaattacttgttt

Exon 10 +      41945      42043   0   Terminal     99   100   Excellent
aatagaaaatgccattactttgtgctaaggggtaggagtatagattcttcagaaggaatg
tagaaagcaggatgctaacagacccaatccatgtttgcaatttacttgatggagatcaga
gaagtaggctaatggtggggaagcatttccctgctgatgttcgtgcttcctggttcacag
GGGCTGGGAACCGACGAGGACTCTCTCATTGAGATCATCTGCTCCAGAACCAACCAGGAG
CTGCAGGAAATTAACAGAGTCTACAAGGAAAGTGAGTAG
cttgatttctgtgattcatcctctcagcccaatttatgtgactctatcatggccactggg
gttagggttcgggctaagatgcctgcattagtgatgtgcagaagtgcctgccaccttgac
tatgcaggcaaggttggctgtggtccaagtttctctccttcacctcctcattgcctgcat

Exon 11 +      43131      43262   0    Initial    132    77        Good
gatttgatctagccctgctgccccctgttatggataataactctggctctgatttcatga
gggcgaaaatcattctagtgaatccttcctctgtttggggttaaggagaatggatatgtc
cagctgacgtagctgttctgcttctcagagtcttagtgggaaatggggagattggggtgg
ATGGTTGGCTACACAGGCAGAAAGCATAAAACCAGATGTATTTTCCTCCAAGTGTACAAG
ACTGATCTGGAGAAGGACATTATTTCGGACACATCTGGTGACTTCCGCAAGCTGATGGTT
GCCCTGGCAAAG
gttggtttcccagtttctttctttgcccttgcttcctcccaaggcaagtcacatacctca
ttttatacttggagtgaattaactaaatcccctgtgcctgcatcagaaattcagctgcat
ttttgaaagtgggtttgcactgtcactgcagagttgtcaattttgtataataggatttct

Exon 12 +      44968      45027   0   Internal     60   100   Excellent
ctaggattacaggcgtgagccaccgtgcccggccccatctatgtttcaaagtaagaaaaa
tcttacgtggttacttatttaggaaattaaataatggcgtacatggactggggagaaaac
attttcagttttaaaatacacaaagaaatgtatttgaagttctttttctttcccccatag
GGTAGAAGAGCAGAGGATGGCTCTGTCATTGATTATGAACTGATTGACCAAGATGCTCGG

gtaagtgctgagctttttgctttgagtttttgttttctggtaagtctctggatagtctat
atagtaatttaactctgtgtgacaaatgactcccaaactctgtggcttaaaacaacaaac
atgtattatttctcagtttctgtgtgtcaggaattgaggagtagattagcccaattgttc

Exon 13 +      46705      46798   0   Internal     94   100   Excellent
gactgcttgtgattaagacttttgacctaaatagtaggtctctgcccatgtctgcagtat
aatcatctttcctcgtttggcattttgaatgtgtagctttttttgttttttttgcatgac
attttttttgacgttacattggatgtgtagttaacttttcctggttggttgtactcgtag
GATCTCTATGACGCTGGAGTGAAGAGGAAAGGAACTGATGTTCCCAAGTGGATCAGCATC
ATGACCGAGCGGAGCGTGCCCCACCTCCAGAAAG
gtgggcactgtgctgagggagtctcagtgccttggggccctggctggggcggctgggtgg
atgtccatgttgggatggagtctgccagaatgaggttctgtctccgcttggcactctcat
aggctcacccattttccctcacctttctctcccattctggattcttttctcttgcaaata

Exon 14 +      47008      47236   2   Terminal    229    46    Marginal
ccttggggccctggctggggcggctgggtggatgtccatgttgggatggagtctgccaga
atgaggttctgtctccgcttggcactctcataggctcacccattttccctcacctttctc
tcccattctggattcttttctcttgcaaatagtttctgcatttggtgctttattctgcag
CTCCTTCTTGTTTGATGATCATTTGGTCTTGCCATTATTTGTTGAAGTAGTGGACTTTGG
TGCATGCTCTGTACTGTTTCCTATGGTTTTCGGATGGAATGGGTTCCACTCAGGGGAGAT
AGAGATGGTCCAAATATGTGGCCTGGGCAGTGCCATTCAGGACAGGTGGTATGGCTGTTC
CACGACAAACTTGGCCAATGTTGGCTCTGGTCACCGTGGTAACCTCTAA
gctcctaggatgctgtgatcatcctcaatttttaaaaaaattatggtgcataaaactagg
tgggtgatcgttgacagctttgactagtggctcggatctgataactctttgttgtttttc
ctcagtatttgataggtacaagagttacagcccttatgacatgttggaaagcatcaggaa

Exon 15 +      47362      47457   1   Internal     96    92   Excellent
ctgttccacgacaaacttggccaatgttggctctggtcaccgtggtaacctctaagctcc
taggatgctgtgatcatcctcaatttttaaaaaaattatggtgcataaaactaggtgggt
gatcgttgacagctttgactagtggctcggatctgataactctttgttgtttttcctcag
TATTTGATAGGTACAAGAGTTACAGCCCTTATGACATGTTGGAAAGCATCAGGAAAGAGG
TTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGG
gtaagtgaatgtggcccccattcctggtagacatcagctaccagagcagaagtgacagat
ggccatcctgttaatccaaatgtgtttgggaggtgtggcttctatgcatgctttggatag
ttttacagtcttaattgtatagatttcagaatataaaactgaagaaaggcctaacttggt

Exon 16 +      47880      47988   2   Internal    109    98   Excellent
cacgtatgcacttgggttctgcaggcctcagagacccctggtttaaaaccgtggtggaac
ttagtattgcagaggatttctagatttcccttagcctgtcctattttgcagcccttttcc
attgcattaggtcacttctggtttgtggcccagggccagggcatcctctctcattggtag
AGGAGAGACCAGAGCAGCTGCAGCGCTGACTCCCTTTCTTCTCTCCACAGTTCAGTGCAT
TCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAG
gtaagggcagctggctgagagagctgtgtttccacactcagcttttcttcttttgggtcc
caaattgagtctccttgattcatggatggaggaaggggaccccactgtgtggatgcagga
acacactagtcagctgtggttgtatgtgacagctgagagaaccacaaatctgtcttcttt

Exon 17 +      49925      50106   1   Internal    182    94   Excellent
acacacatagcctaaaggtaattttatacaacgcttttgataattttgtgcatgaaacag
tttgtgttaagtgctgtatgtggaatttttcattgtggcatcatgtcggcactgaaaaag
ttttggattttggagcattttagatttcagattttcagatcagggatgctcaacctgtag
ACGCTTTCTTTAACGATAACATTCTCAGCGAATGTAACAAATATCAACTTGATTTTCAGG
GCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACA
TGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCC
AG
gtaagcccgaggtgcagtgtcagcctgccctgccgtccagagcaccccgggccctggcag
gtggcctggcagaatgatgacagagtggcgattttctgttttctgactctctggggaaga
gatgctagtcatcaactatcagggatttattttgaaagcaccatttgtgatttgtcctgg

Exon 18 +      51492      51551   0   Terminal     60    91   Excellent
gcttccctggcaatggtttgggtgtggccttccaggcctttgtatcagggcaggtctcct
gcagagtcttctctttgtcatgggagaagcttcattgtgcgttgaggctacttctgtgtt
attgaggagtctgggcttttttctgataccacgtttcttttctttcctgggccattgtag
CAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGA

agcccgacacggcctgagcgtccagaaatggtgctcaccatgcttccagctaacaggtct
agaaaaccagcttgcgaataacagtccccgtggccatccctgtgagggtgacgttagcat
tacccccaacctcattttagttgcctaagcattgcctggccttcctgtctagtctctcct

--------------------------------------------------------------------------------