Gene ZFYVE26 Variant 1
DNA : 70.06 KbNT_026437
mRNA : 9667 bp NM_015346
CDS : 4389 bp NP_056161
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  50 bp
atttcctctttccgagctttctagctttccctactcccggagaggtggcgtcacgtgact
caaacaaatatggcacttaattttcatcttccctgccttgagccaataggagtggggctt
tcagtctttgtcaccacccccaccaccgctgttcggagtgggttctgtcacctgactcgg
CTCAAACATGGCTGCGCTGAGAGCTCTATTGCTTTGGGCGCCGGGAGCAG
gtgagtgtaagacacccctgagagggaggggcccctctccacgacccccgcagagagcgt
ccctgcggcccacccccacactgctttccacttatgacacagattcgtctcctggtcgtc
aatcctctgccttaacagagggctcaaactagggaggttcctgctgaatttctcattctt
EXON 2  277 bp
cgcgtgaagagatgggatccaccccttgaagaaagtgttttcaaaaagtaacgtgggaaa
ttaaactgaaaacgatacttaggcaagcaagtcccgcctttcccaggcggaccagtagtt
gctgctttgtcttaatacagtgccttctgtttcttctcactggcgttgtgttgtttctag
GAGGTACTCCGCGAATGAGAACATTGAGAATGTGTTCGGCATAACTCATTTCTTTGTATC
TCCCTGCACTCTGTGCTGGGAAAATGAATCATCCATTTGGAAAAGAGGAAGCTGCTTCGC
AGAAGCAGCTTTTTGGATTTTTCTGCGAATGCCTGCGGAGGGGAGAATGGGAGCTGGCAC
AGGCATGTGTACCTCAGCTACAGGAGGGACAAGGGGATATCCCAAAGAGGGTAGAAGACA
TACTTCAGGCATTGGTGGTGTGTCCAAATCTGCTGAG
gtaagggatctcttttcctaccagacggtcccagggtgagagacatgtggttcaatattt
gggcattggtcaatgtgcccccactcaactaccctctgaagaataagcagaggcacagtg
tatttcacgtgctctgaaattttacctctatagtatacatccattacttagtcaatattg
EXON 3  79 bp
gcctggcctggttccaatgttttactgaactgtcatatacatttaaaaatatctcattag
ggcagtgtcttgcctgttcaggtttaaaacagaataagcaatgaaatctgtcttggatga
caaaagatgaaagatcagtagaaactcttttttacaagtctttctttttacctttttcag
ATGTGGGCAGGACATCAACCCTCAAAGAGTAGCCTGGGTCTGGCTTCTTGTACTGGAGAA
ATGGTTGGCCCGGGAAAAG
gtaagtaggtttatattaaattttcctccgaggccaggactgagaagaacttgaaagtag
ttgtgggatttcccttctgtctgttacttcctttatcattaaattcatcatactcattct
caaagaatggcttaaatttttattgctgtctccttacctaaattcattcattaatgcact
EXON 4  90 bp
gcctggggaacagagcaagactctgtctcaaaataaaaaaaaaaaaaaaaaaaaaaaaaa
agagtgcttcatcttagagaaatagcagaaataagactaactggacagaaatatttaatt
ataatttgttaactaaaacatatatctcatctctatgcttcattcttttgattcttctag
AAGTTACTCCCAGTTGTTTTCCGGAGAAAGCTTGAGTTTCTTTTATTGTCAGAAGACCTC
CAAGGTGACATTCCAGAGAACATCCTCGAG
gtgagagagagccctggtaccatctgcccagggttgacagtcacttaagcagcttagctt
ccatggacccagaagagagaggtctccaagatgttgcccatactttgttctcaggcaagg
caacacagaagctcctttgaggagagtttagagttagggtaaacttatatgattttagaa
EXON 5  523 bp
atttgatttttctgtgtaaagggccttagaacaatgtctaacacatagtaactacgacat
aagtatttgttaccgccactattatataagtaaactgaaaaagaggaaagcatgaaggca
cacaagtgataccattccaggcatgcccaccacccatccttttcttcatcctctatttag
GAGCTGTATGAGACCTTAACACAGGGTGCAGTAGGCCACGTGCCTGACGGAAATCCAAGG
AGGGAGAGCTGGACTCCTCGTCTCAGCTCCGAAGCTGTCTCTGTGCTCTGGGATCTCCTG
AGGCAGTCTCCCCAGCCAGCACAGGCCCTGCTGGAGCTCCTGCTTGAGGAGGATGACGGT
ACTGGCCTCTGTCACTGGCCTCTGCAGAATGCACTGGTGGACCTCATTCGAAAGGCATTG
CGGGCTTTGCAGGGCCCTGATTCGGTGCCCCCTGGGGTAGTCGATGCCATCTATGGAGCC
CTGCGGACTCTGCGTTGCCCCGCAGAACCACTTGGGGTTGAGTTGCATCTCCTGTGTGAG
GAACTACTAGAGGCCTGCAGGACCGAGGGGAGTCCCCTGCGGGAGGAGCGGCTGCTCAGC
TGCCTGCTGCACAAGGCCAGCCGGGGCCTGCTGTCCCTGTATGGCCATACCTATGCAGAG
AAGGTCACAGAAAAGCCACCGAGGGCTACAGCCTCGGGAAAAG
gtgtgttccctttgctgctgctcctttagtttcagtaattccagtatgcccagccttgct
ggaggctctagactgctgccttccgtgtggctcaggacatctaataggggaggctaagca
aaaatgggtgcgatgctctttcgtaaaagtacaggcctggcatggtggctcaggcctgta
EXON 6  131 bp
gcttttctgaagctcccaagggaagtaaagattctttaagataccctaagataaagtatg
gaaaacccagcctaagtttttaaaagagcaaactctcacatcacttggttgttcaaatgg
gctctagcttagaaaagaagagttcttggtttcctgataaccgtcttgtttgatgttcag
TCTCACCGGATCATCTAGATCCTGAGCGGGCAATGCTAGCCCTGTTCTCCAATCCCAACC
CAGCCGAGGCTTGGAAAGTGGCCTATTTCTACTGCCTGAGCAACAACAAACACTTCCTCG
AGCAGATTCTG
gtaagtcaagcttaattgttcatcacagaggtacccagggattctccccagactttttca
ttcctcatttctctcccactcatttggccaccataaagcagtctaattagtgttgagtca
tttggttttgtccctcccacagtcccatgggaaaggagactctgagaatcagtgccattc
EXON 7  165 bp
ctttggcctcccaaagtgctgggattacaggcatgagccactacgcccagccaaccactc
ctgttattgtcagaaatctccctgctgtactaaaatacttctttctctaaagagcagtaa
gctagaacccattctgtctcatccacatagctgcctataacagctttctttgacttacag
GTAACAGCACTAACATTGTTGAAAGAAGAAGACTTCCCAAATCTTGGCTGCCTACTTGAT
AGAGAATTCAGGCCCCTCAGTTGCCTGCTTGTACTCCTGGGCTGGACACACTGCCAGAGC
CTAGAGTCAGCCAAGAGGCTGCTCCAGACCCTGCACAGGACCCAG
gtaactctcactcagcatcccaggctgctctggaagtgagagacgtggggcttcgggctt
aggctgaatgcagagccctaaaatcagtcataatctgtaaccccaggtgcctgagtcagc
atctctttcttctcccatatcaacatagggcccaggctgtgatgagctcctcagggatgc
EXON 8  89 bp
agaggctgctccagaccctgcacaggacccaggtaactctcactcagcatcccaggctgc
tctggaagtgagagacgtggggcttcgggcttaggctgaatgcagagccctaaaatcagt
cataatctgtaaccccaggtgcctgagtcagcatctctttcttctcccatatcaacatag
GGCCCAGGCTGTGATGAGCTCCTCAGGGATGCCTGTGATGGGTTGTGGGCTCACCTGGAG
GTCCTGGAGTGGTGCATACAGCAGAGCAG
gtatggccctgtgcagtcagcgcctgcccaccacagggcacagctgaccctgtgctccgc
atgtgtggccatttcaaggcgttttccacataaatgttttgagttggcaatgttgaccag
ctactaaaaattgttccaacaattaaaccaagaaagaaacacaagtaattattaccttca
EXON 9  164 bp
ttccctgagggtaaataaatgttaggctcagtcccaaaccaactaaaatttagattgtag
ggaagggaagcctgtggcattatggtccagagaggaagaacaagagggaatggagattga
tctttcttcgagcaataatataaactgcctctcttccatcctcccaacttttccattcag
CAACCCCATACCAAAGAGAGATCTGTTGTATCATTTACACGGTGGAGACAGCCACTCAGT
GCTCTACACTCTCCATCACCTTACAAACCTTCCAGCCCTCAGGGAGGAAGATGTTCTCAA
GCTCTTACAGAAAGTGCCAGCCAAGGACCCCCAGCAAGAGCCTG
gtgagttgggatggaatgacctggccaggatttcctcttaggacattcttacacatttct
tccagcatgagatttatccagatgtgattgctgagatctttcaagagggtggtgaggagg
tctcctctaaatgagcactgtttgtcctaatcagtttatgggatatagggcattcctcct
EXON 10  204 bp
agttgatactgacttgaggaaaagccctagaagtgacacagatcagaccgacagaaagga
gagagggtaagaacctacaagtggacctctaagtatggcacagcatctctttgcttcacc
catacttgcatcctgaattaattaactctcaagttcagcctgtttctctttgtaattcag
ATGCAGTTGATGCTCCAGTCCCTGAGCACCTGAGCCAGTGTCAGAACCTGACACTCTACC
AGGGCTTCTGTGCCATGAAGTATGCCATCTATGCCCTCTGTGTAAACTCACACCAGCACT
CCCAGTGCCAGGACTGCAAAGACAGCCTCTCTGAGGACCTGGCCTCAGCTACAGAGCCAG
CGAATGACTCTCTCTCCTCCCCAG
gtacagcacttccctccatccgtgagataagctgataacaacacatgccagtgggtgctt
tgtgtgtttaccctcttccaccaagattgggagtggggtgatggccttggttttatttca
cccagggatagtttcatccatctgtcagcctctgaatcaaagggacatggaaaaagaaag
EXON 11  609 bp
cattaaaagacatcctaagtctcttattcttctcactgtaacctcagttcccttataatt
aaaaaataaataaatgagctaaagttgcgagaatgtttgacgctgggaggtaatgtttct
aatgtttgcattctctgtcttctctttctctggcctcttctcttgtacatgtttttgtag
GTGCTGCAAATCTCTTCTCAACTTACCTGGCCAGGTGTCAACAGTATCTGTGCAGTATTC
CTGACTCTCTGTGCCTGGAGCTTCTGGAAAACATCTTCTCATTGCTTCTCATCACCTCTG
CTGATCTTCACCCAGAGCCTCACTTGCCTGAGGACTATGCTGAGGATGATGACATTGAGG
GGAAGAGCCCCTCAGGTTTGAGGTCCCCATCAGAGAGCCCTCAGCACATAGCACATCCTG
AAAGGAAGTCAGAACGGGGTTCCCTGGGAGTCCCAAAGACCCTTGCTTATACAATGCCAA
GCCATGTGAAGGCAGAGCCAAAAGACAGTTACCCAGGGCCTCATAGGCACAGCTTTTTGG
ACTTAAAACACTTTACTAGTGGTATCAGTGGATTTCTGGCTGATGAATTTGCAATAGGGG
CCTTCCTCAGGCTTCTCCAAGAGCAACTGGATGAGATCAGTAGCCGCAGCCCTCCTGAGA
AGCCAAAGCAAGAAAGTCAGAGCTGCTCAGGAAGCAGAGATGGACTGCAGAGCCGCCTGC
ATCGACTTTCCAAGGTTGTCTCTGAGGCCCAGTGGAGACACAAGGTGGTGACAAGCAACC
ATCGTTCAG
gtgagagaagggtggaactggtgggaccagaaggtggagagggagaaagatcccaggaat
atgggagagagctaggagtacataggagtcaccccataactcagggcatatcgtcaccat
ggcaaccagtgtcagaacactggggtatgctccatgtctcagagcccagtgcaaaccttc
EXON 12  84 bp
tacataggagtcaccccataactcagggcatatcgtcaccatggcaaccagtgtcagaac
actggggtatgctccatgtctcagagcccagtgcaaaccttccccaacctgttatgccaa
gaaagggccaaatcaaagttgatcactctcctttctgtcccattgggtttgctctttcag
AGGAGCAACCTTCCCGAAGATACCAGCCTGCCACACGTCACCCCAGTCTCCGCCGGGGTC
GTCGGACAAGAAGGAGCCAGGCAG
gtaatctgaagagctcattcccatgcactaggcaagtggtgtaatgctgcttgtctaata
ctctttaagaaacagcacatggtcaaaaacaacaaaagcgttgtaaaattatcctattcc
cactccctcaaggtaacccttgttaatagtttcctatgtatcctttcagaaattttccat
EXON 13  69 bp
caccctttgcctttggtctataggagcttgtgttttgctgtagaaggagcagcaggtgtc
atagttattcattatcctctgtctctaactacacagatcttggctgtcaagccaacttca
cacttcctactctataaggagctgataattgactttctctcttcttcccaatacctgtag
ATGGCCGAGACAGAGGTTCAAACCCATCCCTGGAAAGTACAAGTAGTGAGCTGAGCACAA
GTACGTCAG
gtatgcagatttccaccagttgccaactttgagcagctttgccctgatatagagttgcca
tacaccatggtgtaaagccaggattgagcagtcaaggttgttattcaaggttggcagatg
gccagattttagctgggagaagggaaaggactgtttcattctcaatttagttatccagca
EXON 14  152 bp
cttctattcaaagatggtagcataggtttgcccttcatttgaggaaaaattaagacctat
ttacaggccttttacagaaggacattgaggagataaaagtttggtgggaggtggcagcaa
tatagcatttccttaattcctcttgcttctctggccccacacattcttgtgtcccaacag
AGGGAAGTCTGAGTGCCATGTCTGGCCGGAATGAGCTGCACAGTAGATTGCACCCCCATC
CTCAAAGTTCACTCATCCCCATGATGTTCTCCCCACCTGAGTCACTGCTGGCATCCTGCA
TCCTTCGCGGGAACTTCGCAGAAGCCCATCAG
gtgaggggaggccataccttttcagcccctgaatgacttagcatcaggtaaggctcggag
catgtacaaccagagccacctgggagcactcaggggtccacatcaagcagaagaagcaga
agcaagagggggtttccatgtgcccaggcccagtcttcagcagggtggattgaaagatag
EXON 15  202 bp
acttttatgaattattttttatagttgacctgctcttctaacattcagtgctcttctgac
cctacaaagcacaaagacatcttagggccacagtctaatggttggcaagatctcctatcc
atggacattccctaaatcagtgggaccaccagggcccacacactccctctcctatgacag
GTGCTGTTCACGTTCAACCTGAAGTCCTCACCCAGTTCAGGGGAACTGATGTTCATGGAG
CGCTACCAGGAAGTGATCCAAGAACTGGCCCAAGTAGAGCACAAGATTGAAAACCAGAAC
TCAGATGCGGGTAGCAGCACCATTCGGAGAACTGGCAGTGGCCGCTCAACTCTACAGGCC
ATTGGCAGCGCTGCAGCAGCAG
gtcaggcttccctgctaacaccataagtggtgaggtggctgggagagggggtaaaagggg
agaaaccactaaaatcctaggctcctcatgagggtgagcagaaattaaatacaggacacc
tgccttgaaaaacagcaaacctgatacgtccagttttccagctgtgcccatcctccttgc
EXON 16  264 bp
tcctttcatgccactgttttgaagctataagagtgggccataatgatagtgctaatatac
atgaaagataccctgtgcagatgaacctcaaacattttgaaagtaactactttacctaat
aaaagttgtagtaagaatccttttaaccctttgctttttattcctctgctgggcggccag
GAATGGTGTTTTACTCTATCTCTGACGTGACTGACAAGCTGCTCAACACCTCTGGAGACC
CCATCCCCATGCTCCAGGAGGACTTTTGGATAAGCACGGCTCTAGTGGAGCCCACTGCTC
CCCTGAGAGAGGTTCTGGAAGACCTCAGTCCCCCTGCCATGGCTGCATTTGACCTAGCTT
GCTCTCAGTGCCAGCTCTGGAAAACCTGCAAGCAGCTTTTGGAGACAGCCGAACGGCGTT
TGAATAGTAGCCTTGAAAGGCGGG
gtgagtgtgctgtgttagctgtatcccttcattctcaaatgagatgggtttctgagagtc
ttgataaattgtccaggaagaaagcagttattggaggaggcagatggtgaatggattatg
aaattttgtcacatacaatctgatggcataaatacagtctgttgagagacaaaatagaca
EXON 17  120 bp
gaatctcaggcatgaaataagccaagtatactggttgtcacccaaaatggcacagcatgt
atttcctccttaatattggagaggataaaatttcacaggtaaatacaggactgagtgtca
atctctgaaaacacttcaattttttttttttgcattccctcttccttcatctatttccag
GTCGACGGATAGACCACGTACTCCTAAATGCTGATGGCATTCGAGGTTTTCCAGTTGTTC
TTCAGCAAATCAGTAAGAGTCTCAATTATCTGCTTATGTCAGCCAGTCAAACCAAATCAG

gtgagttgcttttttctcttttcttctcctggacttggaacattaggtcagcaacagact
ttactttttctttctcatttgctttccatagagagtgtggaagaaaagggaggaggccct
ccacggtgcagcatcactgaactgcttcagatgtgctggcccagcctaagcgaggactgt
EXON 18  165 bp
tgatggcattcgaggttttccagttgttcttcagcaaatcagtaagagtctcaattatct
gcttatgtcagccagtcaaaccaaatcaggtgagttgcttttttctcttttcttctcctg
gacttggaacattaggtcagcaacagactttactttttctttctcatttgctttccatag
AGAGTGTGGAAGAAAAGGGAGGAGGCCCTCCACGGTGCAGCATCACTGAACTGCTTCAGA
TGTGCTGGCCCAGCCTAAGCGAGGACTGTGTTGCCAGCCACACCACCCTCTCCCAGCAGC
TAGATCAGGTCCTTCAGTCACTGAGAGAGGCACTAGAGCTGCCAG
gtataaggctgtctgcttgggaacaaataaaagctgaactggggagaggaaacagctgag
agtaacgaagcactttggagcagaggcttgggactccagaactgggatctatcagccctt
tagttagccagggcatgtctcaatgtctcgtaacttaacttcacctgttttcccacctct
EXON 19  219 bp
atcacttgtccaagtgactgacttaggattttatatttgccttgtaagtgtagtgtccag
gccatcagatgccccaggcagtgtatagggggcacagttcacatatccagtcagaaattg
acccaaagctggactcacagactgaagcctgtgtcctttctcctgccatcctcctctcag
AGCCCAGGACTCCTCCACTGTCTTCCCTGGTGGAGCAGGCAGCCCAGAAAGCTCCAGAGG
CAGAGGCCCACCCTGTGCAGATCCAGACTCAGCTCCTCCAGAAGAACCTGGGCAAACAGA
CCCCATCAGGCAGCAGGCAGATGGACTACTTGGGCACCTTCTTCAGTTACTGCAGCACCC
TTGCTGCAGTTCTCCTTCAAAGTTTGAGCTCTGAGCCTG
gtaggtagcaagaaagaggcaatagattcatggcagacctgcaagtgttcagggcaagga
agagaaaagatgcacaattgaaaggctctggatacagcagtagccaagaacactagattt
ataaggttgtcctctcttattcatctctggctattttactcatctttgtgctagtatagc
EXON 20  103 bp
atagataaaacttgtggtcaggttcatgttgagaataccctttacctagaatgaattaac
agaaggctctccatattgtcttcatcttgacactgtacttttttctcaattctgggaaac
agggctctgaactcttgcagtcagtggtgcaaacaaagatcatgttctttacctttgcag
ATCATGTGGAGGTCAAGGTAGGAAATCCCTTTGTTCTGCTGCAACAGAGCTCTTCCCAAC
TGGTGTCACATCTCCTGTTTGAGAGACAAGTTCCCCCAGAGAG
gtaggagccacctccatgcaagtcagccatgggccttcggatgatttcatcaatatagcc
aagggctcagtgcggtggtgcttggggttagcacagagagtggggatttcttcctgactg
aattttttattcttatataactgaaaatttaatgtgccttgtttcctgctttctctctcg
EXON 21  746 bp
gtgaaaacataaagggcagagcgatatgtctaataggctactttttgtgttttaaaaaaa
gagtgtgacaattaggaacttttatttacatttgctcatgtaagcataaagaaattgtaa
gactggttaatggtgcctgtgtattcaggccttgtatgctttctgcttctctccttccag
ACTGGCAGCCCTTCTGGCCCAAGAGAATCTCAGCCTAAGTGTGCCACAGGTCATCGTCAG
CTGCTGCTGTGAGCCCCTTGCTCTTTGCTCATCCCGGCAAAGCCAGCAGACCTCCTCCCT
CCTGACTCGTCTGGGTACTCTGGCCCAGCTACACGCCTCTCACTGCCTGGATGACCTCCC
ACTTTCTACACCGAGCTCCCCGAGGACAACTGAGAACCCTACATTGGAAAGAAAGCCCTA
CTCCTCCCCAAGGGACTCATCACTCCCAGCCCTCACCTCCTCTGCCTTGGCCTTTCTTAA
GTCACGCTCAAAGCTCCTAGCTACGGTGGCCTGCCTGGGGGCTTCCCCGAGGTTAAAGGT
CAGCAAACCCAGCTTGTCATGGAAGGAACTTCGTGGCCGCAGGGAGGTGCCTCTGGCTGC
AGAGCAGGTAGCCCGGGAGTGTGAGCGCCTTCTGGAACAATTCCCTCTGTTTGAGGCCTT
CCTCCTGGCTGCCTGGGAGCCCCTGCGAGGGTCTTTGCAGCAGGGGCAGAGTCTGGCAGT
GAATCTCTGTGGTTGGGCCAGTCTTTCTACCGTTCTCCTGGGCCTACATTCTCCCATTGC
CCTAGATGTACTGAGTGAGGCTTTTGAGGAATCCTTGGTGGCCAGAGATTGGTCCCGGGC
CCTTCAGCTCACTGAAGTGTACGGGCGAGATGTGGACGATTTGAGCAGCATAAAGGATGC
AGTCCTGAGCTGTGCTGTGGCATGTG
gtgagcagaatgctatgcctccctttttcactagtggtaatatttggtattcactgggta
tattatcacatttaatcctcacggtaactctagagagaagccccactataatctcatgtt
attaagaggagaccaggtctcagaggggttaggaaacttgcccagggtggtaagtggtag
EXON 22  197 bp
ttttccttgtcatataatggttccaagtgtaaaaactagttaagatcacatccatcttaa
ggatcctccaagctcctcttttacgagattgaagaaagccctttctcaagaagtaacctg
gactcttgaactcttctggtcccacgcttgctgcctctgagcatcttttttgtcttatag
ACAAAGAAGGTTGGCAATACCTGTTTCCCGTGAAGGATGCATCTCTGAGAAGTCGGCTGG
CCCTACAGTTTGTGGACAGGTGGCCCCTGGAGTCATGCCTGGAGATTCTGGCCTACTGCA
TTTCAGACACGGCTGTCCAAGAAGGACTAAAGTGTGAGCTACAGAGGAAGCTGGCGGAGC
TGCAGGTGTATCAGAAG
gtatgggccctcgcatcaagagaaagggaacgggcttctcactctatgatcaaccccaac
ctatcttatatgatgggggactttaagaaagagaaaatataggtctgggttttgctttgc
atctggcttcagttcttaggtgaacagcagggaggcctcctagctggttgctgtgttact
EXON 23  105 bp
ataggttcactctgctctctaaataatctttgcccaatttgctctcttttctggcaagtt
ctgacagcctgactttggggcagagatctagggatggcccatctgtggacatgcccagtg
acttgttcatggagggagaagctgcagtgtggtttgacggattttcttgtctttccttag
ATTCTGGGTTTGCAGTCTCCCCCAGTGTGGTGTGACTGGCAGACCTTGAGGAGCTGTTGT
GTTGAGGACCCATCAACTGTCATGAACATGATTCTAGAAGCACAG
gtaccgttttcctgggtggtgttccccttcatcctcctttcagagttacaaccccttagc
tggctgtataagcccctttctgcatatcaatgttcactttttaaaaaaataactatacca
cattctggccgaggcgggcggctcacaaggtcaggagatcgagaccacggtgaaaccccg
EXON 24  123 bp
ttttttatggtagtgctaagaggaaagtgatatgaacagtaagcctgcttcaatcatttt
catcatagtgaagttcccatcagcacttataaacattcctggggctttgtagactcaaga
ctgctgagaagaatcaggcagtcatgtaaaggggttgaaggcatgtgtgtttccttccag
GAGTATGAACTGTGTGAAGAGTGGGGCTGCCTGTACCCCATTCCAAGAGAACATTTAATC
AGCCTTCATCAAAAGCATCTTCTCCACCTTCTAGAAAGAAGAGATCATGACAAGGCTCTG
CAA
gtaagcccccagttctttccatttttcttctggggtgggacaagaagtttagtcaaatca
gatggctttattttcatgttgaatcccatgcaatctcagctatgcctcttctgatctttc
aggagctggttatagtcatcttgagcagaaggggcctagccttgcattaggtgccagatg
EXON 25  177 bp
ctggtcctgtcaaagccatggcatttgggaaactacagaggtggttaaaaaaaaaaagga
gtatagagaaagggttagtccaaaatgagtaaacctaaatattctattctcaaacaaaac
aaagctggtctaagagctcttctgcaggccacaccttcctcctctaccctttgacaatag
CTCCTGCGAAGAATCCCTGACCCCACCATGTGCCTTGAAGTGACAGAGCAATCCCTCGAC
CAGCACACTAGCTTGGCCACTTCTCACTTCTTGGCCAACTACCTCACCACCCACTTCTAT
GGACAACTGACTGCTGTCCGACACCGTGAAATCCAGGCGCTGTATGTGGGATCCAAG
gtaaggatacaccgtgaaatccaggcgctgtatgtgggatccaaggtaaggaggaaaagg
aggtgttgggaaggcatacctgagggagagactgcgagcctagctcttcttcagaacttg
ccttttcaatggctcttttgccaggcacctgccatccctggcctgtgctatatgaaatct
EXON 26  247 bp
attaccatctgcagaatttagtggggagctcagccttcctaaaagactgcgagtctgttt
cagtagctggctatgcaccttttgttctcatgcacccttccccttcccagtgagaatctt
gagttttttctgaaatttgtgtactattttctttactctatggatctaccccacaaacag
ATTCTGCTGACCCTGCCTGAGCAGCACCGGGCCAGCTATTCCCACTTGTCCTCTAACCCC
CTGTTCATGCTGGAGCAGCTGCTTATGAACATGAAGGTGGATTGGGCCACTGTGGCTGTG
CAGACTCTCCAGCAGCTGCTGGTTGGACAGGAGATTGGCTTCACTATGGACGAGGTGGAC
TCACTGCTTTCCAGATACGCAGAGAAAGCCCTGGACTTTCCATACCCTCAGAGGGAGAAA
CGATCAG
gtaactgctagcatcctagaaggggattctacatggaggaagaaatgccatgctgcattc
ttagttttaatttgctccccttttaatattttgggttgatctagagtgaatgaatacact
tcagaagagctatctctttattatataggagagatcttggtcttggaggaagtagaataa
EXON 27  99 bp
ggcgtttaagaaacatgcgtgctatgggcttagaggtacctcctccattctcttaatacc
tagtagagtcatggaatgacaatcagagaagccaacagagctttgttctaaatgcctagg
gtggtgaatcaagatacttatggtagaaccatattttgtcagcattttccctctctacag
ATTCTGTGATTCACCTCCAAGAAATTGTCCACCAGGCTGCAGATCCCGAGACCCTCCCTA
GATCACCATCAGCAGAGTTCTCTCCTGCTGCTCCTCCTG
gtaagaactggctctgatgattcactaaaatttttcagtttagtcttgccttattctatc
cttcagaattttttttttttttttgcttctttttttcattgccagttacaacattattaa
ttgtttatcttggttcattccagatttatatatatctcaaaagattcaacatacagtcaa
EXON 28  164 bp
caggaggcacacaatgttcagttgtctctcttttatgacacaaacagtcactgatgatca
ttaactggatctattctttcaataacggtttgtaaaatggtaaaattctatcattccctc
ttcatctataagctggtatattgattaccttttactctgacctctggctctgcctcccag
GTATCTCCAGTATACATTCCCCTAGTCTAAGGGAAAGGAGTTTCCCACCAACCCAGCCCT
CACAGGAATTTGTGCCCCCAGCGACACCCCCTGCCAGGCACCAGTGGGTACCGGATGAGA
CTGAGAGTATCTGCATGGTCTGCTGCAGGGAGCACTTCACCATG
gtaagcagcatcggtctccactgtcaccctcaggagaaggtaaaggagaattctagttca
tgagcctgagtttacaatcaccgcctgtccccaggagaatatcggtattttcagaactgc
caaatctaagactttgggttcatttttgacctgaccagaatgtattttctggattcagac
EXON 29  137 bp
atttttaaacattcaatttttgagggcaaggactggtgtgtccttttccaatagagaccc
aagcagttggtgttcttagaaagtataagccactggtagttaataccatgtataaatgga
ttgatggcaatctccccttctctcctccctctttcttctcctcctgatggcattcctcag
TTTAACAGGCGTCATCATTGTCGCCGCTGTGGCCGGCTAGTGTGCAGCTCCTGCTCCACT
AAGAAAATGGTGGTTGAAGGCTGCAGAGAGAACCCTGCTCGTGTGTGTGATCAGTGCTAT
AGTTACTGCAACAAAGA
gtgagtgtcctacagcagggctgttgctattattgaccgctgcacccttccgcaggtccc
tacactcctaggagtctcattatgagagcatttcaaatccagaaatgtttaacattcaca
ctgaaatgccattaactctacactgaagggtttgtacactgactttggtcagagaaacca
EXON 30  32 bp
actgctgagatttgaaatgggcagttagtattgatgggggactctttcattcaacaattc
taccctcaaagagccctccattgtaccagggagacactgtaagttgatgctgtctacgaa
gctcaaaacaaagaagtgactcaggcatttatttaataatttttctttctctgttttcag
TGTACCAGAGGAGCCTTCAGAAAAACCAGAAG
gtaaggccaaatcccgttctctgtgactcttcatttgtgtacttaagttgactctatctt
cagcatatcagctgtgactgatatacttgtccaacttatgcactccatccaacttgtttg
ccaaagcaaattcttggcatttgtatcagcctgtttcctctgaagttcatcatattaacc
EXON 31  137 bp
ggaagatggtttgaggtgcttagtggggtgtcctaaagcaaacaaaaggaaccaaggaga
gagaaaggggccctgagatagcaggcaagtgtctacctgcaactcatgccagctcactgg
actgggttagactgaactgccagccagtgaatgacacatgaatggcatttctcttctcag
CTCTAGACAGCTCCAAGAATGAAAGCCCTCCATACTCGTTTGTGGTGAGAGTCCCCAAAG
CAGATGAGGTGGAATGGATTTTGGATCTCAAAGAGGAGGAAAATGAGCTGGTGCGGAGTG
AATTTTACTATGAGCAG
gtaatagcaataaaatgcaatggtcacttaagtttctttatgatgtgtagcagtatgaca
agaaatacagaggtaggtgaacacacctggcctttacttgtttatagtgcaataatatgg
gagctaaaccagtaaatccattaaggcagaaaataatgaacatcttgggaattgcagaag
EXON 32  221 bp
acttagaacatctgaaatttgtttagttccacttctgctttcttgtagaatctggttcct
tcttccagggtctttcagccttttgaaaggggaaggataatttctgccacccagctgcct
ttggagaatgctctggcccctggactcaccgtgtgttctcccttcttccaccccggccag
GCCCCCAGCGCCTCCTTGTGCATTGCCATCCTGAATCTGCACCGGGACAGCATTGCCTGT
GGTCACCAGCTGATTGAGCACTGCTGCAGGCTCTCCAAGGGCCTCACCAACCCAGAGGTG
GATGCCGGGCTGCTCACGGACATCATGAAGCAGCTGCTGTTCAGCGCCAAGATGATGTTC
GTCAAAGCCGGCCAGAGCCAAGACTTGGCTCTTTGTGACAG
gtagagggcagtgggtctctattcttttacacaggagcagtttctagccagcttcttttt
ctgaccccactgtgatttttttatctcaccatcctctctgacaagacatgctgaaagatt
tttcatctgtgtaatgttgatgaaacggtgttgccagatctcaagtgttcttccccatcc
EXON 33  148 bp
acccaggaggcggtggttgcagtgagccgagatcggaccactgcactccagcctgggtga
cagaacgagactctgtttcaaaacaaacagaaaaaagaaaatggaataggaaacctttaa
gcggctactcttagtaagacactagggagcctcatggccttgcccttttcctccttgtag
CTACATCAGCAAGGTAGATGTGCTGAATATTTTAGTTGCTGCTGCCTATCGCCACGTGCC
ATCTTTGGATCAGATCTTGCAGCCAGCTGCAGTAACCAGGCTAAGGAACCAGCTTTTGGA
AGCCGAGTACTACCAACTGGGCGTTGAG
gtgagacaaagacaaagacaaagcttacttccaccccactgtagcaagttgcttttgctt
agccttgcaaacaggtgttgccgtctctcagttgtcctgcccatggggtagaatcgggga
catgactagtttgccagcagagaagtaatggcagatagtgggaatgaggtggttggcaac
EXON 34  210 bp
gccgtctctcagttgtcctgcccatggggtagaatcggggacatgactagtttgccagca
gagaagtaatggcagatagtgggaatgaggtggttggcaacttgggaatagaataggtct
ttgggacatttaggcctgaatgtagctaccactcactaaaaggggcaatttttctcccag
GTCTCCACAAAGACTGGGCTTGATACCACCGGGGCGTGGCATGCTTGGGGCATGGCCTGC
CTCAAAGCCGGGAACCTCACTGCTGCACGGGAGAAGTTCAGTCGCTGTCTGAAGCCCCCA
TTTGACCTCAATCAGCTGAATCATGGCTCAAGGCTGGTGCAGGATGTGGTTGAGTACCTA
GAGTCCACAGTGAGGCCCTTTGTATCCTTG
gtaagagcaaggcaggaagagtgcctggctcagggagggagacccaggaatagcaatgac
ctgggaaaagaatcagtggaaattcagctaacagtgtcagtcctggctcagcatcaagca
ggttaaaaattttttttttccatcacatatagttagataagtaaccatatatggttagat
EXON 35  219 bp
tatttttttatcatactttaagttctagggtacatgtgcacaacgtgcaggtttgttaca
tatgtatacatgtgccatgttggtgtgcacattgttaaatattctttgcaagcaatattt
tcagtgcctgctgagaactttttgagtttcatttttctctctcgctccctgtgctgtcag
CAAGATGACGATTACTTTGCCACCCTGAGGGAACTGGAAGCTACCCTTCGGACGCAGAGC
CTTTCTCTGGCAGTGATTCCTGAAGGGAAAATCATGAACAACACCTACTACCAGGAATGC
CTCTTCTACCTGCACAACTATAGCACCAACCTGGCCATCATCAGCTTCTACGTGAGGCAC
AGCTGCCTGCGGGAAGCTCTTCTGCACCTTCTCAACAAG
gtgggacatggacacagctcaaaaaggcagtgcctgccttactcctctggcttggaccac
tcagccttaagcgggacaataaccccctgacacttaaccctgtgttgagctatggggcca
tctctagcagagtcaagtcaaaacaggggactctgcacaactgttattcagtgagtgtga
EXON 36  198 bp
gagaagtgaagcagtcgctagaatgagattctcaaaggtatctgtgacacataaaagatt
aagaagcactgcattgggaggatgctgaaggttcatcaatagaaggaaattcagagtgga
tcccagacagtgccagaaccaggctcaagacttctgacttctcgccctgccctgctccag
GAGAGTCCTCCAGAAGTTTTTATAGAAGGCATTTTCCAACCAAGCTATAAAAGTGGGAAG
CTACACACTTTGGAGAACTTGCTAGAATCCATTGATCCAACCTTGGAGAGCTGGGGAAAG
TACTTGATTGCTGCCTGCCAACATTTACAGAAGAAGAACTACTACCACATTCTGTATGAG
CTGCAGCAGTTTATGAAG
gtaatggcagccccttcctgccttctacctctgttgctggtgccccaccctgcaggagag
gcagtgcacgatgagggaatgagactgtcattggtccctggccttgctgtttggctgacc
ctagagcaaatccatgttgctctccagtattgttaaataatattaggatttccatcctaa
EXON 37  200 bp
tgcacttcaggatctcttggaccttgggggtgactggctcaaaatagcagttcagctggt
ggtgggagtgggtgctggaaacaaggtctcataggcagaaatcagatgagaattctcatc
acaccccaccctccaaacccctgatctactttgacctgaacatttattttcctcttctag
GACCAAGTTCGGGCCGCCATGACCTGTATTCGGTTCTTCAGTCACAAAGCAAAGTCATAT
ACAGAACTGGGAGAGAAGCTCTCATGGCTACTTAAGGCCAAGGACCACCTGAAGATCTAC
CTCCAAGAAACATCCCGCAGCTCTGGAAGGAAGAAAACCACATTCTTCAGAAAGAAGATG
ACTGCAGCTGATGTGTCAAG
gtagctggaggttcaggggactattggtgtggggcagaaagggtgggagcagttgtctgt
aggtgatgaagctactcttgtccattccttgaatcctgaaaaaaaatctaaagggaatca
tccctggatgacagtgtgtagtacaagcctagaaagcctacagaggagctggtagtggga
EXON 38  142 bp
cacgagatcaccatttttttggtcttgtcataactgctcacaaggtacttgaggtctctt
ttcccactatatcatttgttttccctttttcattgccatattattcgacttctcagtctc
ctggcctcagtcacctggggcccctcatgaggctggactgtgcatattctgtcaccacag
GCACATGAACACACTTCAGCTGCAGATGGAAGTGACCAGGTTCTTGCATCGGTGCGAAAG
TGCTGGGACCTCTCAAATCACCACTTTGCCTCTGCCAACCCTGTTTGGAAATAACCACAT
GAAAATGGATGTTGCCTGCAAG
gtacatgcagcgtttcagacctctggcagactattgtcatcttttagaacacttatcata
attgcagttgtctagtgattatttcagttgtttgtttgatggctgcctccccactagaat
atgagccaccaaagactggtgatcaggtccattttgatcattcttatatccctagtgcct
EXON 39  60 bp
gccaccaaagactggtgatcaggtccattttgatcattcttatatccctagtgcctggca
cttagcagggtctcaacaaatatttgttgaataattgaataaatagaggccttcattctt
ggtcaagagtattctctagtaattgccatgtttttaagcatgattccctttccttttcag
GTCATGCTGGGAGGGAAAAATGTAGAAGATGGTTTTGGAATTGCTTTCCGTGTTCTGCAG

gtatgacttggatcattcaaatcatactgaggacaatcagcacctgaccacagttccggg
agagattattctttaggaaattcttatcccaagaaaagtggatttacatgcacattaggg
atgaaatcaaggatgtgactgttacagaactgggtcaaattcaagactctaggccacttt
EXON 40  183 bp
tacctaactccaaagaggaattgacgcttgctttttgtttggtatatttatgttttctac
tgtgaccacaatcaatatggcttatctacaccaagcatagtgagagcttttaaatgctgc
ctccctccccaccgttaacgtttcctgctcctaagcccatcatgttgtgttctgttctag
GACTTCCAGCTGGATGCTGCCATGACCTACTGCAGAGCTGCCCGCCAGTTGGTGGAGAAA
GAGAAGTACAGTGAGATCCAGCAACTGCTCAAATGTGTCAGTGAGTCAGGCATGGCAGCC
AAAAGTGACGGGGACACCATCCTCCTCAACTGCCTGGAAGCGTTCAAGAGAATTCCGCCC
CAG
gtacactccctcccgtacctcttggctcctccatcaatttcagtgtcttcacatccccat
ctttattgttctgttttccataatgtgcctgaaactctacaagatccttttatcattctg
aacccctctgcaataatggcctcaccataattgacccttccctgtaaagaaaatttatgg
EXON 41  45 bp
gaaaagccactacactccagcatgggcaacatagtgagaccccatgtctttgagaaaaaa
aaagtcaggcagacattttcattctgaagtcagaatggctgggctgaggctgggttgggc
cctggctcccagactgcgggactcttctccctctcacagtgctgtttctgttctgcacag
GAGCTGGAGGGCCTGATCCAGGCAATACACAATGATGACAACAAG
gtgagcggaattgtctccaaacgctggtgatgccaatgaattgtgtctcaggcttgccta
gtcacctttatcccttgctccccacaatagttccatacaacccgtatctcagcttctgta
ttatcagaggtggagctgaggcttggataggggtgtagaaaggagggaatagatgaggag
EXON 42  2118 bp
ttatagcatatgtccagaatattgaaagagttgttataataccataaaatacatgaatcc
tgttatgaacgtggcaggtgagacatggtgtctgtctgcccgagctttctgctgcagctc
tgtatacttgatttgtcggtgatggatgcctttccgctgtctcttataactgactgccag
GTTCGGGCCTACCTGATATGTTGCAAACTGCGTTCTGCCTACTTGATTGCTGTGAAGCAA
GAACACTCACGGGCCACAGCCCTTGTCCAGCAGGTGCAGCAGGCCGCCAAGAGCAGCGGG
GATGCAGTAGTGCAAGACATCTGTGCCCAGTGGCTTCTGACAAGCCACCCCCGGGGTGCC
CATGGCCCAGGCTCCAGGAAGTGACCTTGGGCAGTGGGGCCAGGAACACGTGGCCTGAGA
GCTGGGCAACAGCAGTGATGGCGATGCCCTCCACCTCTTTCCTCCAGTGGAGTGGGACTT
CTCTGGCTCTGCCCTAGGTTGGAAAGAGTTGGATTGGACCCTACTTGCCTTCCCGGGCAA
GGATAGGACCTTTCACGCAAGTGCCATGTTTCTCTAAAATTGTGGAATCTATGTGTGTTT
GTCTGGAGATGGCCAGTTCTTTCTACCTCAGAGTGAGTGAGTGAGTATGTGTGCACACAC
GTGTGCATGTTCCTGTGCGCTGATGTTTACGCCCAAGCATTTCTGAACAAATGAAACTCT
TCTCCATTTAAAAGAGGCACTTTACTTTAGACTTGCCACTCTGAAAACCTTCCCTGCGTT
TTGGTTCTTGACCCGGGTTGTCCTGTTTGTATAGTCCCCCCTCTGTGGACGTGCTTTAGT
AGCTCCTCTTACCTAGAGGGCTTTTACAGAGAATTAGAGCAACACCAAAAGGATTGCCTC
TTTTCCTTCCTTCCCATTCCAAAATTCAGAGATGGCTTTGGGGCAAGTGCTACCTGTGGA
ATAAACCTGTTTTCCAGGTGTCTCTTCTCCCAAGCACAAGAAGTCCTGGAGTCTTTGGAA
GGTAGTCTGAATAGAAGGGTTTTCAGGTGCAGGCATCTGAAAGCTGTGGGTATGTGTATA
AATGATCAGGTCTGTGAGGCTAACACGGGCAAGAGGGAAAGAAAGGCTAACCATCCAAAC
AGGGATACAGGGGAGGCGGTGGGGGGTGGTGGGGGGAGCGGGTGCTCACAAGCACAGAGC
TGCCTGTTGTGAATGTCCCTGCTGCAAAGTTGGTGGGTGAGAGAATGGGACTTCCTCTTT
GAGAGTCTGGGGAGAGAAAAGGTGGCCAGGATCCTAGGACTGAATGACTCGATTTTACCT
ATTTGAGCTGCAGTCCTGTTTGCGCTCCTTGAATTGGTTAGGAAGCTGCTTCCTTTTCCC
TCCTGCTTCCCTTCAGTCTCTTCAGGACCACAGGATGGATATGCAGACATGTGGGGTCAT
TGGGAAGGGAGTGCGCTTCTTTTCTCTGTCTTAGAAAAGGGAGTCAAGGGTTGGCTTTGG
AATTGGGCCTCTGGACAGAGTCAGAATGAGGGAATAATGAATAGGTCACATCTGGTTGGT
GGAAAACTAGGTGAAGTGCTTCTTTAATATGCACTGTCTTGTCTTCCCACGCAAGATGTG
ACAATGTTTGAGAAAAGGTGTGTCATACTCAGTGACTTCAATTTGCAAATGTGGGGCCTA
AAGAAAGCTCTGCAGCTCTGAACCTCTCACTGGCCAGAGCTCAGCCTATTGGTCCCATCC
ATGATGCTGAGACAAACAGAAACTGGAAGCTGAAGTCAGTGTCTCTGGTGCTCAGAAACC
CTGTGGATTTCCCTCTGAACCAAGATTTTTAGTAGTAAAATAAACAACTCATGGACATCT
GTCAGATGAGAAGTTTTGGTCCTGTTAGAGAGGAGAAAGACTGTAATGAAACTACTAGAC
CCATTTGGGCTAAAGTTTGGCTTTTCCTTCCTTGAGTCATAGAACGTATCCATCTCCCAG
GAAATGTCCTTCTCTGGCGTCTGCTTGCCCTTCTGAGTCTGCCTTTTTTGCACTGAACAT
AAGCACTTTATACTAATGGGTCACAAATCTTGCAGCCCTTAATTTGGGATAAGACCAGAT
TTTCCTGACATTTTCCTCTAACTCATTGAACTATCAAATTATAGGCAACCACTGACTAGA
CTGATATGAGATGAGGCTAAAAGCCTTTGAACACCACGCTGTAGTCTCCAACAGAAAAAC
ACCACCAAAACAGATACCCATGTTGAGGGGTTGAATGTTTTACTACAAACAAGCCACAAT
AAAGTGTCTATCAACATG
tttcttggcttcataacttcttggtgctgtcttgctcctaccctttgcatcctttttcct
tgtggaaagaaaagggagtggggaagatcagatggccttcaattcagacttagtctaaat
aatccccataatgactaatgactttgcttaggatttatctcatttcctatgtgtttaaac