Gene ZFP36L1 Variant 1
DNA : 5.41 KbNT_026437
mRNA : 3022 bp NM_004926
CDS : 1017 bp NP_004917
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  187 bp
ttttgaaagtttcttctcctccccctgccccccctccccgcctgaccgcatggctgattc
aactccagtgtcaatcaacttctttttcctcctcttcctcatttaaataagtttaaagct
cctcctccccccggcccaccaaatctgaactttataaattgggctttgcgcgccccagcc
CGGAGTCAGAAAGGCGAGGGGCGCCGGGAACTGGCGTGTGGGACTCCAGACAGGAGAGGC
TGCGCCTTCCCCGCACCGGGACCTTCGCGACACACCAGATCCTCGCCCCTGGCTCGCGCG
AACGCACAGGATGACCACCACCCTCGTGTCTGCCACCATCTTCGACTTGAGCGAAGTTTT
ATGCAAG
gtaaaggggggcggagcatttgcttttcaaaaagtctttttcttttgccttaagaaagaa
cccccaaaagtttgggtcttggaaggcaatggggaaagtggtgcagcgagatgattcttt
tctcctccggcatttctcccaagtttgaaggaatttggccccgtccttcccaccctttga
EXON 2  2835 bp
caaaataaacccaggtgaatggcctatgggagggagagagggaagggagcttgctagagc
cgaggtagagatgagttctttgagaaagagcgggcgtttgtgattgtgtagggggctgcc
catagtggacatcctggtggatgtcctctgtccttaccatcctttctcttctctctccag
GGTAACAAGATGCTCAACTATAGTGCTCCCAGTGCAGGGGGTTGCCTGCTGGACAGAAAG
GCAGTGGGCACCCCTGCTGGTGGGGGCTTCCCTCGGAGGCACTCAGTCACCCTGCCCAGC
TCCAAGTTCCACCAGAACCAGCTCCTCAGCAGCCTCAAGGGTGAGCCAGCCCCCGCTCTG
AGCTCGCGAGACAGCCGCTTCCGAGACCGCTCCTTCTCGGAAGGGGGCGAGCGGCTGCTG
CCCACCCAGAAGCAGCCCGGGGGCGGCCAGGTCAACTCCAGCCGCTACAAGACGGAGCTG
TGCCGCCCCTTTGAGGAAAACGGTGCCTGTAAGTACGGGGACAAGTGCCAGTTCGCACAC
GGCATCCACGAGCTCCGCAGCCTGACCCGCCACCCCAAGTACAAGACGGAGCTGTGCCGC
ACCTTCCACACCATCGGCTTTTGCCCCTACGGGCCCCGCTGCCACTTCATCCACAACGCT
GAAGAGCGCCGTGCCCTGGCCGGGGCCCGGGACCTCTCCGCTGACCGTCCCCGCCTCCAG
CATAGCTTTAGCTTTGCTGGGTTTCCCAGTGCCGCTGCCACCGCCGCTGCCACCGGGCTG
CTGGACAGCCCCACGTCCATCACCCCACCCCCTATTCTGAGCGCCGATGACCTCCTGGGC
TCACCTACCCTGCCCGATGGCACCAATAACCCTTTTGCCTTCTCCAGCCAGGAGCTGGCA
AGCCTCTTTGCCCCTAGCATGGGGCTGCCCGGGGGTGGCTCCCCGACCACCTTCCTCTTC
CGGCCCATGTCCGAGTCCCCTCACATGTTTGACTCTCCCCCCAGCCCTCAGGATTCTCTC
TCGGACCAGGAGGGCTACCTGAGCAGCTCCAGCAGCAGCCACAGTGGCTCAGACTCCCCG
ACCTTGGACAACTCAAGACGCCTGCCCATCTTCAGCAGACTTTCCATCTCAGATGACTAA
GCCAGGGTAGGGAGGGACCTCCTGCCTACTCCAGCCCCTACCCTGCACCCACATCCCATA
CCCTCTTCTCCCTACCCATCCCATTCCCCACAGGCCCTACATTAACAAGGTTAAGCTCAA
CCCCTTTCCCCCAGCACCTCAGAATGTGCCCTCCCTCTCCCCCTCATAACCCCACCTAAC
ATAAGGACAAGTCAATTTGTCAGTAGCTTCTTCTGGCTTGAAACCCCCTCCCTGGATTTT
ATAGCCCACTTACCATGCATAACAGACAAGTCCCATATTTTGTCAGTAGATGCCTTTTTT
TTTCCGGCTTAAGCCTTAAGTGCCAAATCACAAGAGAAAAAGCAGTAACAGTTTACAGAA
GCAACTTAGTGCCTTGTAATCTAACTTTGTCACTGTGACTACATTACCTCTTCAGCGCCA
GAGGGCACCCGTGGGCCTCCCGGAGCCTCTGCCCATGGCGGGGTGGAGACCCGGAACCAG
CAGCCCCCTCCACTGGCGACACAACTGCACCTTCCCTCATTTCAGTCTCCCGCACACTTA
TTCCTCCTCCCCTCTTCCCGGTGGCACCTCTCCACCTGTACCCGCCCCCCCACCCCCCCC
ACCCCTGCCCCTTGGAAGAGTTGTTGCCAGACCAGGGTTTTGGGGGAAACCTGTCTTGAC
ATTCAAAACCTTTTTCTTCCCGATCTGAACCCCTGTTGACTAATCTTGCCTGGGTTTGTG
TAGGTCTGCAGGAAGGAAGGCTGAAAAAGCGGACGAAGATTTTGACTTAAGTGGGACTTT
GTGATTTAATTTTTTCTTTTTTTTAAGTGGGGAGGAAGGGGAAGCTAGATGGACTAGGAG
AGACTTGATTTTGGTGCTAAAGTTCCCCAGTTCATATGTGACATCTTTTTAAAAAAAATA
ACAACAAAAAAAAAATGAGAGAAAAGCTAAAAAAAAAAAAGTAAGGGGTGAGCAGTTAAT
GGTATTCATTCCACATACAATATCTGTGTAAAACGATTTCCTGTAGAAGTAGCTTTAATG
GTTTTTGCTCTAGAATACCGTAGGTCTATCCTTAGAGCACTCACGCCATGCTTTCTTCCC
TGGGTTTTAAACTTCATATAACTTTCAGAAATTGGAGAGCAAAAATTTTGCTTGTCACTG
CACATCAATATAAAAAAGCTTATTTAACTTATCAAAACGTATTTATTGCCAAACTATGCT
TTTTTTTGTTAATTTTGTTCATATTTATCGGGATGACAAATCCATAGAATATATTCTTTT
ATGTTAAATTATGATCTTCATATTAATCTTAAAATTTTGTGACGTGTCTTTTTCCTTTTT
TTCCACAGTTTTAATATATTATTCTTCAACGACATTTTTTGTAACTTTACACTTTTTTGG
TTATTTTATTTTAAAAAAATGAAAAATTAATTTAAAAAAATGCAAAAAACTGTTGGATTA
TTTATTTTAGAAATTCCCCCCTTTGTGTTGGACTGCAAATTGAGTTTCTTTCTCTTTAGG
CCTTTCACAACTAGGACTGAGAATGTATGTAAAAGTTCTGTGACAGTACAGAAGGAAAAC
AACTTTTTATGTATAGCTTCTAAAAGGGGAAAAAAAAAAAAAGAGAAACCCTTTGACTTC
CACGTGCCCATCTCAAGACATTCCACTCACAGATTTGAGGTTCTGGATTCCAGGTCTGGA
GTTTTCCAATGTTAATGTAAACAGAACTGGCACACACACATTAAGATGAATGTAATTATT
ATTCCTCTTGCTGGTCACTACCGTCGCTTTCTATTTCTCTTTCTTTGTGTGAATTTATTT
AAAAGAAAAAAAAACTTTTTGTAACGACTATTTGCAGTTTAAAAATCAATAAACCCCGTT
TTTTCAAGAAACATT
gatggtggagctggttttacttggttttggtttgactttgccagtaaggttctccccttg
tataccttgcaagtcctgggtagggggaggcggagagagagggctgtggctgtgggtggc
ggcatctctcatccctataagctaagcctatagctcccttccttgatgctggcagtttgc