Gene TM9SF1 Variant 1
DNA : 6.21 KbNT_026437
mRNA : 2122 bp NM_006405
CDS : 1821 bp NP_006396
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  17 bp
agagcggtgtccagcgcggtgtagccgcagccgccgctgtcaggcgcagcaacgggcaac
cccgtagaagtcggtcggcaggtcctctccaacccgccgctaccgcgccgctgtgggaga
gaccccagcaggagcccaaaggcagctacgggggcgcgaaggccgctggcgccgcctcgg
CCAGCCCTTCCCGCGCG
gtgaggaccccggggctgtggcgggaagggacccgaggtgcgagaccgagcggcgttgcc
atggaaacgggccagggcgcgtagtagaggccccgggccagacgggctgcgggtggggtg
aaccccaggttgggaggatgagagagcagaggtggagcggggtctttgggatagagagac
EXON 2  362 bp
ttgggaggatgagagagcagaggtggagcggggtctttgggatagagagacgtggggtag
ggtgaggcggggagggggccaatgggagcaagtggagccaggggacctcagttcgaggca
cctgacctggggtttctgtaacctccctggtttctataacctcaggattcccccaaacag
GTTCCACTGCCTTAAGGATGACAGTCGTAGGGAACCCTCGAAGTTGGAGCTGCCAGTGGT
TGCCAATCCTGATACTGTTGCTGGGCACAGGCCATGGGCCAGGGGTGGAAGGCGTGACAC
ACTACAAGGCCGGCGACCCTGTTATTCTGTATGTCAACAAAGTGGGACCCTACCATAACC
CTCAGGAAACTTACCACTACTATCAGCTTCCAGTCTGCTGCCCTGAGAAGATACGTCACA
AAAGCCTTAGCCTGGGTGAAGTGCTGGATGGGGACCGAATGGCTGAGTCTTTGTATGAGA
TCCGCTTTCGGGAAAACGTGGAGAAGAGAATTCTGTGCCACATGCAGCTCAGTTCTGCAC
AG
gtcagcctctccacattggctatcacgtagccctccttcccagagactaacagtgcctta
catttatggttcagggtacctttatggaaattgtctgatttgattctaactacaatacaa
cccagtgtggcaggcaggttaggtgatgctattctaattcagttgactaagatacatact
EXON 3  622 bp
agttgcagtaagccgagatcgcaccactgcactccagcctgggtgacagagcaagactcc
atctcgaaaaaaaagaattatccaccccaaaatatcagtagtgctgaaggtgagaaactt
tgctgtaactctgcgcctggggagatcttgtgtgaccaactcctgacttgctctttatag
GTGGAGCAGCTGCGCCAGGCCATTGAAGAACTGTACTACTTTGAATTTGTGGTAGATGAC
TTGCCAATCCGGGGCTTTGTGGGCTACATGGAGGAGAGTGGTTTCCTGCCACACAGCCAC
AAGATAGGACTCTGGACCCATTTGGACTTCCACCTAGAATTCCATGGAGACCGAATTATA
TTTGCCAATGTTTCAGTGCGGGACGTCAAGCCCCACAGCTTGGATGGGTTACGACCTGAC
GAGTTCCTAGGCCTTACCCACACTTATAGCGTGCGCTGGTCTGAGACTTCAGTGGAGCGT
CGGAGTGACAGGCGCCGTGGTGACGATGGTGGTTTCTTTCCTCGAACACTGGAAATCCAT
TGGTTGTCCATCATCAACTCCATGGTGCTTGTGTTTTTACTGGTGGGTTTTGTGGCTGTC
ATTCTAATGCGTGTGCTTCGGAATGACCTGGCTCGGTACAACTTAGATGAGGAGACCACC
TCTGCAGGTTCTGGTGATGACTTTGACCAGGGTGACAATGGCTGGAAAATTATCCATACA
GATGTCTTCCGCTTCCCCCCATACCGTGGTCTGCTCTGTGCTGTGCTTGGCGTGGGTGCC
CAGTTCCTGGCCCTTGGCACTG
gtgaggtgataaaaatgaattggggatttatctcatgggatagaactaggtagggagttt
gttcagaaaaggtctgtggatcttctcttctatccagaggggcagacctaagggataggg
tggctctagcaagaatgcacgtattctattgtagattttctggatagcaaaactggggga
EXON 4  186 bp
gggatagggtggctctagcaagaatgcacgtattctattgtagattttctggatagcaaa
actgggggagattgttttgctggaggccctgggtctgggagaaggggggctgattcctct
gaaattgctagaagagacacaggtgaggcctaacttgggctttccgctaccgtcctgcag
GCATTATTGTCATGGCACTGCTGGGCATGTTCAATGTGCACCGTCATGGGGCCATTAACT
CAGCAGCCATCTTGTTGTATGCCCTGACCTGCTGCATCTCTGGCTACGTGTCCAGCCACT
TCTACCGGCAGATTGGAGGCGAGCGTTGGGTGTGGAACATCATTCTCACCACCAGTCTCT
TCTCTG
gtgaggactttcctttccctggtgggcctttctggacttaggaatgaagaacacattgtg
gctggtcacagtggctcacacctgtaatcctagcactttgggagaccgaggccggaggat
cacttgagcccaaaagtttgagacaagcctagacaacatagtgagaccctctctctataa
EXON 5  274 bp
gggacctgaaagggtggaggtgaaggcagtcgactctgcagggacatccaggagcatgag
tctgccgttagagtggcaggctgcttcagccccctccccttttggtcctggatgtaagtg
ggtgcccttagagatgtagctcctagtgttgaccctccctccgggggcccatccctgcag
TGCCTTTCTTCCTGACGTGGAGTGTGGTGAACTCAGTGCATTGGGCCAATGGTTCGACAC
AGGCTCTGCCAGCCACAACCATCCTGCTGCTTCTGACGGTTTGGCTGCTGGTGGGCTTTC
CCCTCACTGTCATTGGAGGCATCTTTGGGAAGAACAACGCCAGCCCCTTTGATGCACCCT
GTCGCACCAAGAACATCGCCCGGGAGATTCCACCCCAGCCCTGGTACAAGTCTACTGTCA
TCCACATGACTGTTGGAGGCTTCCTGCCTTTCAG
gtatcctccctttattccatggctattactgtcaggttcctgacctcaatttttcctgtc
cctactcatccagtaccctaacccaacccgttgatccctggttcagtggtaccattcaga
gatcattaaatggttcctcctatccccaagcaggactgagcttgaatgatatgagagtgt
EXON 6  661 bp
cggctaatcataggcaaaaaatccccatgaagccaggagatctggggcagagagtggagt
gaactcacttttcacaatgacccagcaacatgggagagggtgggggctggatttcagccc
agccactgtgctgatggtgcacagccctttaatgctgtgtatcatctcttttcttcacag
TGCCATCTCTGTGGAGCTGTACTACATCTTTGCCACAGTATGGGGTCGGGAGCAGTACAC
TTTGTACGGCATCCTCTTCTTTGTCTTCGCCATCCTGCTGAGTGTGGGGGCTTGCATCTC
CATTGCACTCACCTACTTCCAGTTGTCTGGGGAGGATTACCGCTGGTGGTGGCGATCTGT
GCTGAGTGTTGGCTCCACCGGCCTCTTCATCTTCCTCTACTCAGTTTTCTATTATGCCCG
GCGCTCCAACATGTCTGGGGCAGTACAGACAGTAGAGTTCTTCGGCTACTCCTTACTCAC
TGGTTATGTCTTCTTCCTCATGCTGGGCACCATCTCCTTTTTTTCTTCCCTAAAGTTCAT
CCGGTATATCTATGTTAACCTCAAGATGGACTGAGTTCTGTATGGCAGAACTATTGCTGT
TCTCTCCCTTTCTTCATGCCCTGTTGAACTCTCCTACCAGCTTCTCTTCTGATTGACTGA
ATTGTGTGATGGCATTGTTGCCTTCCCTTTTGCCCTTTGGGCATTCCTTCCCCAGAGAGG
GCCTGGAAATTATAAATCTCTATCACATAAGGATTATATATTTGAACTTTTTAAGTTGCC
TTTAGTTTTGGTCCTGATTTTTCTTTTTACAATTACCAAAATAAAATTTATTAAGAAAAA
G
gctcatgcagttggaggttttggtctggatataggaactcgagccctgctgttaagggca
cggtcctttataaagccgagctggccactgaatgcccgaagctcgagttctccaacccag
cttgggaactcccggcgtggggaacctacattgccagagtcgggtttccgcgattcagcc