Gene SRP54 Variant 1
DNA : 46.53 KbNT_026437
mRNA : 2147 bp NM_003136
CDS : 1515 bp NP_003127
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  191 bp
ggaaactgaaaccaaaaaccagtgtaagcaagtaaacatctaaactgtttcaggagccgc
gtagaaggaacgcggcggtgtgccccggaagcggaagtagattctcctatagaaaggctg
gactacgcggagtggtgacgtttcctcattgggcggaaggttcgctggcactccgttggt
CTTCCAGCTGGTGGGAGTTGACGACGTGGTGCTGGGCGTTGGGACCCTACTTTATCTAGT
TCGGGAAGTTGGGTTGTGGGGTCATACCTGTCTGTCTGCTCCCAGCTTTCTTGGGTTTCT
TCCGACGGCGTGGGGCCTCGCTAAGGAATTCCCGGCCCCTCAGGGCCACGGCTTTAGCGG
TGTCTTTTGCG
gtaagtgtctgctttttcccgccccagactacggagggggagcgaggggcagccccagcg
ctgctcaggaggcgagagactccgggggaagtcggcctccgtggccaccggccatcgtta
ccgagactgagtttctgtggctctttatctcgtcttccatgagaagttttattaaagatg
EXON 2  111 bp
cataaccaagtagcagttttatctttatgacatgactgtatttaagcacaggttgaggct
atggaaggtgatcttacagtatctaaacactagagtaatttgaacttaaatactctttag
aactcttcagtcatgggaagtgaaattgattattctcacttaattttttttctgctgtag
AGTTCTTCGTAAGTACATCTTAAAGCTGTCAAGATGGTTCTAGCAGACCTTGGAAGAAAA
ATAACATCAGCATTACGCTCGTTGAGCAATGCCACCATTATCAATGAAGAG
gtatgtaaaatattgtatgaaatatatatgattgtatattgtcactagcattgggaagat
ggcttattcataatccctgtatttatatgtattttgatgtagacttaatacttgtagata
aaagcctaaaagtggatacagtaagtagtgttttattgagaaattaactacaacttcaaa
EXON 3  92 bp
ggtctcttattttgacaaaatgactaaacatttaataaaattatctctccaagaactaac
tgaaaaacccagtagtgtggtattactaagctgtggttatgtaagtgatcaacaattgtt
tttatggaactgaaatgaaacattgggtgctttaaatttcatttatttctttattttcag
GTATTGAATGCTATGCTAAAAGAAGTCTGTACCGCTTTGTTGGAAGCAGATGTTAATATT
AAACTAGTGAAGCAACTAAGAGAAAATGTTAA
gtaagttaaatcaatcaggtaaaacacaggcacagtttagtttagtttactggaaagagg
tgctaactggaagtgtttgctgtatcaggaatcatttctgctctgcaccactggaaaagt
gctgtgttggagctcatatgttgggcgagagcatgtgtagtacgtttccataatgatggt
EXON 4  85 bp
tgggaaaactctttatgatatagacttacgagtctgtagtaattacatgcatgttaattg
gaagactattaatatgaatgactgaatgttgtacattctttggagcagaagcttcttttt
cttagagtttcttaactgattttctcctccccaccccaatcaccaaccaccatcataaag
GTCTGCTATTGATCTTGAAGAGATGGCATCTGGTCTTAACAAAAGAAAAATGATTCAGCA
TGCTGTATTTAAAGAACTTGTGAAG
gtaaaagtatatgaagattatgctgtgattctatactcagtggataaaaaagcgttagca
ctacaaatatttcagaatttttaaatatgttttttatggaatattcatctgtattaaaat
attaatgaaaggattattgagttttcttagggacctttttttttttttttttgagaagga
EXON 5  105 bp
gcatcatttgagcccaggaggttgaggctgcagtgagctctgattatgccactgcactcc
agcctgggtgacaagagtgtgaccctgtctcaaaaaaggaaaaaaaagttgtggggaagg
ggttttgaatttatatgtatgttaacctgattttatttttaatttatttttggtatttag
CTTGTAGACCCTGGAGTTAAGGCATGGACACCCACTAAAGGAAAACAAAATGTGATTATG
TTTGTTGGATTGCAAGGGAGTGGTAAAACAACAACATGTTCAAAG
gtaaattgaacttaatttaaaaagaagtcatatggaagataggtttgtataaatcaagtt
ttgtatttaatataaaaatgtaaagcctggctttataatgttgaaatatatattttatta
attataattattagaatgcatttatatattataaataatgttattttatataaaatatat
EXON 6  67 bp
ttagaatataaaactttgtaggaaatttgccacattcaaaaatctttaataatattttca
ggagaattataagcagttttattttactccttaggtaaataataaggaaaaacagaaaaa
attatatgtatagtttgttatattttatgatattatatttttaaatcttttctcacccag
CTAGCATATTATTACCAGAGGAAAGGTTGGAAGACCTGTTTAATATGTGCAGACACATTC
AGAGCAG
gtaatgtcttgaaatttgaaaattgttttatataatttttattttcaagtttgaggattc
atgaactctttatcttccaggggcttttgaccaactaaaacagaatgctaccaaagcaag
aattccattttatggaaggtaggttactgttttttattttaacacttatatccctcttct
EXON 7  58 bp
tgatattatatttttaaatcttttctcacccagctagcatattattaccagaggaaaggt
tggaagacctgtttaatatgtgcagacacattcagagcaggtaatgtcttgaaatttgaa
aattgttttatataatttttattttcaagtttgaggattcatgaactctttatcttccag
GGGCTTTTGACCAACTAAAACAGAATGCTACCAAAGCAAGAATTCCATTTTATGGAAG
gtaggttactgttttttattttaacacttatatccctcttcttgtctgtcagcttttttt
tttttttttttttgagacggagtctccctctgtcacccaggctggggtgcaatggtgcga
tcttggctcactgcaaccaccacctcctgggttcaagtgattctcctgtctcagcttcct
EXON 8  151 bp
atgcttcatgcttttttagaagtagattctgtatttaatactttatagattttcctcttc
taaattgaaattggggtcattttggctttttcaaaatagattataggtaaattaactttc
cgaattagtagtatttggaagttttgtcgttttgttaaatcatttgtccatgttatatag
CTATACAGAAATGGATCCTGTCATCATTGCTTCTGAAGGAGTAGAGAAATTTAAAAATGA
AAATTTTGAAATTATTATTGTTGATACAAGTGGCCGCCACAAACAAGAAGACTCTTTGTT
TGAAGAAATGCTTCAAGTTGCTAATGCTATA
gtaagtagctttcaatgtaacactattattaggactttggttaatttaattataaaacca
ggttgagtatatgaccaatataaattattctttgcctgtgaggcagatccccagtaattt
atttttgttttgggcacctatatctatgtggtagggacttaatttcattatttttgttct
EXON 9  149 bp
ccaggctggtcttgaactatctcaggtgatccacctggctcggcctcccaaagtgctggg
attacaggcatgagccactgcacctggctctaaatattgttttatagcttctaatgatga
catttgcttaggatcaataaaaatcttttctaaagtatcttttctatttaaactttctag
CAACCTGATAACATTGTTTATGTGATGGATGCCTCCATTGGGCAGGCTTGTGAAGCCCAG
GCTAAGGCTTTTAAAGATAAAGTAGATGTAGCCTCAGTAATAGTGACAAAACTTGATGGC
CATGCAAAAGGAGGTGGTGCACTCAGTGC
gtaagtatcattgatactgttgtcctctgtcttgggattatatggggaaggatatgtgtt
tatagctttcatattgatcatttaaaatatgtttcaatagtgagcctaatatggtttata
aagaaagtttaaatagaaacaattttggagcctgtctgatataggtctattataacttgt
EXON 10  101 bp
tttaaatagaaacaattttggagcctgtctgatataggtctattataacttgtgaaatga
aacttgagttttgtacctttgtctaattagctttggaggcggattcacttcgaatttcag
atctgctggaaatttgtggggttcttttgaggttattttatattttctttttttttccag
AGTCGCTGCCACAAAAAGTCCGATTATTTTCATTGGTACAGGGGAACATATAGATGACTT
TGAACCTTTCAAAACACAGCCTTTTATTAGCAAACTTCTTG
gtatgtacagtggtggggatatagaaaaatctccaagaaatacgatgtatctttaggaca
aaataggattttaattctgtcctcactaatttaagcacatcatttctttctgtgacttag
tttccttacctgtaaaatagagataatggttatctgccctctgtggtgaaagtggtaaaa
EXON 11  87 bp
gccaccgctcctggccatgccacttaactttcttagctttggttttctcatttgtgtagt
gtagtaagaatacctaacctattataacctcacaaggttattatgtatgtgaatgtgttt
tgtataatgtgaagcagggtatagtattagttgttaatttttcttttttgtatcttatag
GTATGGGCGACATTGAAGGACTGATAGATAAAGTCAACGAGTTGAAGTTGGATGACAATG
AAGCACTTATAGAGAAGTTGAAACATG
gtatatgagtgacaaaaaagcacttcatctcagatttcttccattgattttttttataaa
gttactattaagttatttgaaatgtaatatctgttagagtcagatcttccactgcttatt
attttagatgatttatatgcaaatcatttaaaatctcaggtacctgagcagttacagaat
EXON 12  74 bp
atgtattctccccagcattcatcctgtcatcttgcacatggtaactgcttggtgaatatt
tattgatgtatattttataaatatgcttcaagatgaattcatgattaaggaataaattag
ttttgttgaatggaaatgtacatactttaatatatccgaattatttacattgtatttcag
GTCAGTTTACGTTGCGAGACATGTATGAGCAATTTCAAAATATCATGAAAATGGGCCCCT
TCAGTCAGATCTTG
gttagttatccttaaaactttataccttcttttgttttcattaaattttctaaaatagat
acacttgctttaattatttttacattcgggtaaaaatatatctaagacttagtgtcaata
ttaaacctaatagttaaatgtggacattttgaaccattaatcttaagctactattgactt
EXON 13  109 bp
tataccttcttttgttttcattaaattttctaaaatagatacacttgctttaattatttt
tacattcgggtaaaaatatatctaagacttagtgtcaatattaaacctaatagttaaatg
tggacattttgaaccattaatcttaagctactattgactttatgtttaaatctgttgtag
GGGATGATCCCTGGTTTTGGGACAGATTTTATGAGCAAAGGAAATGAACAGGAGTCAATG
GCAAGGCTAAAGAAATTAATGACAATAATGGATAGTATGAATGATCAAG
gtaagatggcagattattttcctcaggcaaaaatgttctgagtatcagtaagatgagagt
ttcactgtattcttgtggacaagatggggagaaatttagcctgaaagattatttttaggt
agatttgtaatagcttgaaagctcttactcaaagggttatgattattggattgccttcat
EXON 14  171 bp
ctatgtattatgtctgtttttctgtatgtaagatattttgtaatataaaaagaaaaatga
gatagttatcactttaaaaacatctgctaagctctttgaagttatatattgcccatttgc
acataactgctttgatggtgaatgataattgtgtgtgagagtaactgaccttgtctacag
AACTAGACAGTACGGATGGTGCCAAAGTTTTTAGTAAACAACCAGGAAGAATCCAAAGAG
TAGCAAGAGGATCGGGTGTATCAACAAGAGATGTTCAAGAACTTTTGACACAATATACCA
AGTTTGCACAGATGGTAAAAAAGATGGGAGGTATCAAAGGACTTTTCAAAG
gtaagaaaaataagcttgttattagttaacagacggaaaagaaaggaagttgagaaaaaa
gagtgctgccagtattggaaaattcacagctgaatttcatgttattttcaagtacttcca
ggatttatgtgacctgtgatttatctgttttcatattcaaggtaatattaatatttaaaa
EXON 15  96 bp
gtaattgagaaaaagattagaagggaatatgtagaaatagaaagaattatgttagagtga
taggattatgtaattttttcttagtattttctcagttcatcaaactttctattataccct
gattatactgattatattacctcctacgctgactcaaaatctttttttttttcccctcag
GTGGCGACATGTCTAAGAATGTGAGCCAGTCACAGATGGCAAAATTGAACCAACAAATGG
CCAAAATGATGGATCCTAGGGTTCTTCATCACATGG
gtaaataccaagttgttggcagttgctaatgcagtttaatttataagggttgagttttaa
tgataagccttttattgtaatattatgaaaatatgttcaaaaggtgtgtgatttcaggga
aatggtcatctgaatcctaagttgaattcaattgtaatagggcttattagctgaggtctt
EXON 16  500 bp
ttgatgaagataactggtgataatacaaatttttaggtggtacgttctttaaggctgatg
actaaattgcaatcagaattcagtatttttagaagtacttattaggcaaaagtaataaat
gtttccagttctgcttaataattctctgtttttaactctacttccctacttttgctctag
GTGGTATGGCAGGACTTCAGTCAATGATGAGGCAGTTTCAACAGGGTGCTGCTGGCAACA
TGAAAGGCATGATGGGATTCAATAATATGTAAAGAAAATGCCTTAATATAAACTGACTCA
GTTGAATACCTAATTTGCTGAGACCTCAGCGTTTCCCTTCTTTTTGCGAATTGGGGGGAA
AGTGTATTTTTCTTGCTTATCATGCACTCTTTCCTTTTCTTCTCGCCCGCTTTTCCCCTC
CTTTTCTTTTTCCTTCCTTCTTTCCTCCCTTTAATATAAGGGAGAAATACATGGTTTTTG
TGGAAATCATTATATGTTTGCTTTAGATTTTCTTCTGTTTTCACCATCATAACACTTAAG
TTAAATCATGATGTAAAATTTTAGTACTTAAAGGTTTTTAATTATCTCGAAGGCCAAGCA
TTGCATTTGTAAACAGTCCTGGTCAGTAGTTAAATAATGTTTCAATTAAAGTGCTGTAAA
ATAAACTTCAAAGTGGTTAT
aagttaaggggttgttaactttctttatggttaaacattatcagtttatcacactaaaaa
ctcaatggaaaagccagtagataaatgtcatttaaaactatgcctggggccgagcacggt
ggctcacgcctctaatcccagcactttgtgaggctgaagtgtggatctcttcagcctggg