Gene SIX6 Variant 1
DNA : 2.50 KbNT_026437
mRNA : 1391 bp NM_007374
CDS : 741 bp NP_031400
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  667 bp
gcgccgccaatccgcccaccccaatagcggagccagctcgcctgccggcgtgcctgagcc
gagccgagcccgaaccccaagccgcggagccagcacctcctccagtcggggtcgtccgct
cccggccgttgagccaccgccgccacccggtagtgtgtcccgctgccccaatccgcctca
TCAACAAGCGCCTGGCACACTCAGCCAGGCCCGCGGGCATCTGCTGCGTGTCCCGCTCCG
GGCTCAGTGCCCTCGCCGCCGCCGGCACTGCCTCGATGTTCCAGCTGCCCATCTTGAATT
TCAGCCCCCAGCAAGTGGCCGGGGTATGTGAGACCCTGGAAGAGAGCGGCGATGTGGAGC
GCCTGGGTCGCTTCCTCTGGTCGCTGCCCGTGGCCCCTGCGGCCTGCGAGGCCCTCAACA
AGAATGAGTCGGTGCTACGCGCACGAGCCATCGTGGCCTTTCACGGTGGCAACTACCGCG
AGCTCTATCATATCCTGGAAAACCACAAGTTCACCAAGGAGTCGCACGCCAAGCTGCAGG
CGCTGTGGCTTGAAGCACACTACCAGGAGGCTGAGAAGCTGCGTGGAAGACCCCTGGGAC
CTGTGGACAAGTACCGAGTAAGGAAGAAGTTCCCGCTGCCGCGCACCATTTGGGACGGCG
AACAGAAGACACACTGCTTCAAGGAGCGCACGCGGCACCTGCTACGCGAGTGGTACCTGC
AGGATCCATACCCTAACCCCAGCAAAAAACGTGAGCTCGCCCAGGCAACCGGACTGACCC
CTACGCAGGTGGGCAACTGGTTCAAAAACCGCCGACAAAGGGACCGAGCGGCTGCAGCCA
AGAACAG
gtcggtacctagaggcctccgcgctttgagcgcaccggggaggaggcgggtggaggcacc
tctggcgcccttacccagtccctggcgactccaattcagcaggagttgggagcgcggtct
gtcttgggttaagagccctgcgttctgggctcctggccgggagttcccttgccggctctg
EXON 2  724 bp
aggggcggccgcggactcctgcccgacctctgtcgccttgccgagtaatcctcgccttaa
ctgctggggtcttcggaagaacctctagccgccgggctggagggacgcaggaggtggtgg
gggcgggcgacgggcggctgtgttacgagctgtgacccgtgttccctttcttccccgtag
ACTCCAGCAGCAGGTCCTGTCACAGGGTTCCGGGCGGGCACTACGGGCGGAGGGCGACGG
CACGCCAGAGGTGCTGGGCGTCGCCACCAGCCCGGCCGCCAGTCTATCCAGCAAGGCGGC
CACTTCAGCCATCTCCATCACGTCCAGCGACAGCGAGTGCGACATCTGAGTTGCCCATCC
AGGATGCTCAGAAGCAGATTCCAGTGTAAAAACGAGAAAAACAAAATGAAAGAGGGGAAG
AAGATGAGAGACCTGCAAATCCAGCGCCACAGAAGCCAGGTGACCAGGGACCCGCGGGCT
CGGGTTGCCGTTTCCCGCCCCACCCCGCGGCCGGCCTGGCTTCACTGGCGCCCTTTGGCC
GCGACCACGGGAACCAGCGGTGAGGCCTGACCCAGCACCACGTTCTTCTTGCTTTGCTTT
TTCCTAAGGATTTTGCTGCAAAGTCTCCTTCGGAACCCGAACTGCAAGCTGAGCGCCTGC
CCAGATTCTCCCATGGGTATTTCACGTCGAAAGGACGCTGTTACATATGTATAACTTTCG
CTTTAAAGTTTTTTTTTAACAAAACATATATATGCTGTTTATTTACTTATTTAAGAGACC
GCCATGGTAGGTTTCTCTGTAGCTTGGGGAACTTGCTGTTTCTAAACATGCAGGCTGGTG
GTGATGGGTTCTGTGTGGAGAAGCCAAACAATAAAACAACCTAGTGGGCAACCTTCTTAA
TTAA
gggagctgctctcagattccttttcttcttattattattaatatcattcccttcaccagg
catgcagggacccttgagcaaatggtctccggaaggtcttacctatatatcttttgcctt
ctttggtgcttcctggtatatgttttaaacaacctatggtaggtctataaccacctccca