Gene SIX4 Variant 1
DNA : 10.60 KbNT_026437
mRNA : 2283 bp NM_017420
CDS : 2283 bp NP_059116
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  800 bp
gggctttccggagggggagaggagggagggagacgaaggaggaggagtaagagaggagga
aagaaagaggaaaagagtgcgagggagtgagggagggaggaaaataaacaacaaaaaatg
tcctcttcctcccccaccgggcagatcgcaagtgcggcggacatcaagcaagagaatggg
ATGGAAAGCGCCTCGGAAGGGCAGGAGGCGCACCGAGAAGTGGCGGGGGGCGCGGCGGTA
GGGCTGAGCCCCCCGGCTCCAGCCCCTTTTCCCCTGGAGCCGGGGGACGCCGCGACCGCT
GCCGCCAGGGTGAGCGGAGAGGAAGGGGCAGTGGCGGCGGCGGCGGCCGGAGCGGCGGCG
GATCAGGTACAACTCCACTCGGAACTTCTGGGCAGGCACCACCACGCCGCCGCCGCCGCC
GCGCAGACCCCGCTGGCCTTCTCGCCCGACCACGTCGCCTGCGTGTGCGAGGCACTGCAG
CAGGGGGGCAACCTGGACCGCCTGGCCCGGTTCCTGTGGTCCCTGCCCCAGAGCGACCTG
CTACGTGGCAACGAGAGCCTGCTGAAGGCGCGGGCGCTCGTGGCCTTCCACCAGGGCATC
TACCCCGAGCTCTACAGCATCCTCGAGAGCCACAGCTTCGAGTCGGCCAACCACCCGCTG
CTGCAGCAGCTCTGGTACAAGGCGCGCTACACCGAGGCCGAGCGAGCCCGCGGCCGGCCG
CTGGGAGCCGTAGACAAGTACCGGCTGCGCAGGAAATTCCCCCTGCCCCGCACCATCTGG
GACGGCGAGGAGACGGTGTATTGTTTCAAGGAGAAGTCGCGCAACGCGCTCAAGGAGCTC
TACAAGCAGAATCGCTACCCTTCGCCCGCCGAGAAGCGGCACCTGGCCAAGATCACCGGC
CTCTCCCTCACCCAGGTCAGCAACTGGTTCAAGAACCGCCGGCAGCGCGACAGGAACCCC
TCCGAGACCCAGTCCAAAAG
gtgagcgccaactttcctcctcctcccccttcctctcccccacccccttcccggctttct
tttcctccaagtgctcgcaaacatggcgcttaccttccccaccagcctggtccggctgcc
cacctctccccgccccctacctcgctccccggccggcagaggtagggggcggcggaggcg
EXON 2  686 bp
ctggctggtcggaatctgctgaaaggcctcttagtttaaataggactagcagatatcctg
ctgtgctttccttaaatactgcctttaatggatttagaagctggttttccaaacaagtgg
cactgtgtagaatgtcatccccctgaccttctgaacattttgatttccccctccatacag
TGAGTCAGATGGCAACCCCAGCACTGAAGATGAATCCAGCAAGGGACATGAGGATTTATC
TCCTCACCCACTCTCCAGTTCATCTGATGGCATCACCAACCTCAGCCTTTCCAGTCATAT
GGAGCCAGTATATATGCAACAAATTGGAAATGCTAAGATATCATTAAGCTCTTCTGGAGT
TCTGTTGAATGGAAGCTTGGTACCTGCAAGTACTTCACCTGTCTTCCTTAATGGAAATTC
TTTTATTCAGGGACCCAGTGGAGTTATCCTTAATGGATTAAATGTGGGAAATACACAGGC
AGTGGCATTGAACCCACCAAAAATGTCATCAAACATTGTGAGCAATGGTATATCCATGAC
TGACATACTGGGGTCTACTTCCCAGGACGTGAAGGAATTCAAAGTCCTCCAGAGTTCTGC
TAACTCAGCAACCACCACGTCCTACAGCCCCAGTGTCCCTGTCTCATTCCCAGGCCTGAT
ACCCAGCACTGAGGTGAAAAGAGAAGGCATTCAAACAGTGGCTTCCCAAGATGGAGGGTC
TGTAGTGACTTTTACTACACCAGTGCAAATTAACCAGTATGGCATTGTCCAGATCCCCAA
TTCCGGAGCAAACAGCCAGTTCCTTAATGGGAGCATTGGATTCTCTCCACTGCAGCTGCC
CCCTGTGTCAGTGGCAGCTTCACAAG
gtaacaatctcatttggtaccttaatgcaccagcaaatgtgttcatcagctgctgtaagt
gacgcatttggtgatagctatagattgatgtttctgttcaggtaccttattagctgccga
agctgtagagtagccttgatgtgattctcctctttcacaatacccatgtcatatccaggt
EXON 3  797 bp
agagcctgggaatctgtagttttaggtgcccaaggtaattctgaaccagaattgggctaa
atgattgtatggaagtgttgcttctttatagatactgtacctgagaaaaaaacgtgtgtg
taactttttttctttccctctcacttccatcagtgataatcagtactttattttttttag
GTAATATCTCAGTAAGCTCAAGCACTTCAGATGGAAGCACATTTACAAGTGAGTCTACCA
CAGTCCAGCAAGGAAAGGTTTTCTTGAGCTCTCTTGCTCCCAGTGCAGTGGTATACACGG
TTCCTAATACAGGCCAGACTATAGGATCTGTGAAACAGGAAGGCTTGGAAAGGAGCCTGG
TATTTTCTCAGTTGATGCCTGTCAATCAGAATGCACAAGTAAATGCAAACCTGTCTTCTG
AAAACATCTCGGGGAGTGGCCTGCATCCACTGGCCTCCTCATTAGTTAATGTATCTCCAA
CTCACAATTTTTCTCTCAGTCCCTCTACACTACTAAATCCCACTGAGCTAAACCGCGACA
TTGCCGATAGCCAACCAATGTCTGCACCGGTGGCAAGCAAATCTACTGTGACATCTGTCA
GCAACACTAACTATGCAACTCTTCAGAACTGCTCCCTTATTACTGGTCAAGACCTATTGT
CAGTCCCTATGACTCAGGCTGCCCTTGGGGAAATAGTTCCTACAGCTGAAGATCAGGTAG
GTCACCCCTCCCCAGCAGTACATCAGGATTTTGTCCAAGAACATCGTTTGGTTCTGCAAT
CGGTAGCTAACATGAAAGAGAATTTCTTATCAAATTCTGAGAGCAAAGCAACAAGTAGCT
TAATGATGCTGGACTCTAAATCCAAGTATGTCTTAGATGGCATGGTTGATACTGTCTGTG
AAGACCTGGAAACAGACAAAAAAGAGCTTGCCAAGCTCCAGACTGTCCAGCTGGATGAAG
ATATGCAAGACTTATGA
actttatttcctcctcacctctttttggcatcagcggcaaatcttttcatgaagccccaa
ggacacaaaacattttcccatttaaaggaaaacactctagttttgcaagtatatgcatac
aagagactttagattgatctgcatgaagatcacagttaagtatacaggagtagaactgca