Gene SIX1 Variant 1
DNA : 3.43 KbNT_026437
mRNA : 1376 bp NM_005982
CDS : 855 bp NP_005973
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  833 bp
aacccccagctccgcagcctcgccctccccgctctgggcggtgcggcctctctgcccagc
cgggcggcgcgctggctggccagccccggataggcgccgccggcagccaatcagcgtgcc
ggggacgctgcgcgctttaaggccgctgcggggagaacagaaaccaagttccccggcaac
TAGCAGCATCCACCGGGCGGGAGGTCGGAGGCAGCAAGGCCTTAAAGGCTACTGAGTGCG
CCGGCCGTTCCGTGTCCAGAACCTCCCCTACTCCTCCGCCTTCTCTTCCTTGGCCGCCCA
CCGCCAAGTTCCGACTCCGGTTTTCGCCTTTGCAAAGCCTAAGGAGGAGGTTAGGAACAG
CCGCGCCCCCCTCCCTGCGGCCGCCGCCCCCTGCCTCTCGGCTCTGCTCCCTGCCGCGTG
CGCCTGGGCCGTGCGCCCCGGCAGGCCCCAGCCATGTCGATGCTGCCGTCGTTTGGCTTT
ACGCAGGAGCAAGTGGCGTGCGTGTGCGAGGTTCTGCAGCAAGGCGGAAACCTGGAGCGC
CTGGGCAGGTTCCTGTGGTCACTGCCCGCCTGCGACCACCTGCACAAGAACGAGAGCGTA
CTCAAGGCCAAGGCGGTGGTCGCCTTCCACCGCGGCAACTTCCGTGAGCTCTACAAGATC
CTGGAGAGCCACCAGTTCTCGCCTCACAACCACCCCAAACTGCAGCAACTGTGGCTGAAG
GCGCATTACGTGGAGGCCGAGAAGCTGCGCGGCCGACCCCTGGGCGCCGTGGGCAAATAT
CGGGTGCGCCGAAAATTTCCACTGCCGCGCACCATCTGGGACGGCGAGGAGACCAGCTAC
TGCTTCAAGGAGAAGTCGAGGGGTGTCCTGCGGGAGTGGTACGCGCACAATCCCTACCCA
TCGCCGCGTGAGAAGCGGGAGCTGGCCGAGGCCACCGGCCTCACCACCACCCAGGTCAGC
AACTGGTTTAAGAACCGGAGGCAAAGAGACCGGGCCGCGGAGGCCAAGGAAAG
gtacgcggcgtgcttcccgcgactcgggcgaccctaggaagccgtcctttctcctccgcc
ccctcccgcccccgcaggcaccagccaccaagtcctccccgccggccggagcccgtccac
ggggcggcgcgcaggccctccgcggcgctgcagcgaaagttcatgaactctgaggttcct
EXON 2  543 bp
cccccattacccttggggatgggtggaagggtagagctcctccatttgggttggtgacag
attgcacaatggccctttcctccttccagctcccctccctccatctcacacttttttttt
aacctactttttttttttttttttttttttaaccatatggtgttgtcctctatttcttag
GGAGAACACCGAAAACAATAACTCCTCCTCCAACAAGCAGAACCAACTCTCTCCTCTGGA
AGGGGGCAAGCCGCTCATGTCCAGCTCAGAAGAGGAATTCTCACCTCCCCAAAGTCCAGA
CCAGAACTCGGTCCTTCTGCTGCAGGGCAATATGGGCCACGCCAGGAGCTCAAACTATTC
TCTCCCGGGCTTAACAGCCTCGCAGCCCAGTCACGGCCTGCAGACCCACCAGCATCAGCT
CCAAGACTCTCTGCTCGGCCCCCTCACCTCCAGTCTGGTGGACTTGGGGTCCTAAGTGGG
GAGGGACTGGGGCCTCGAAGGGATTCCTGGAGCAGCAACCACTGCAGCGACTAGGGACAC
TTGTAAATAGAAATCAGGAACATTTTTGCAGCTTGTTTCTGGAGTTGTTTGCGCATAAAG
GAATGGTGGACTTTCACAAATATCTTTTTAAAAATCAAAACCAACAGCGATCTCAAGCTT
AATCTCCTCTTCTCTCCAACTCTTTCCACTTTTGCATTTTCCTTCCCAATGCAGAGATCA
GGG
aaaaaaaaaaaaaaaaacccaaacaaacaaaagcacccaggcacccagtctgagttctgg
gcaactgatacgcctgtttcagcagcctttcttttttttcaatgaatgggaattgcaaat
caactggattttcattatttccttttaatttatatatggagaaatgtgaagagggaaagg