Gene RTN1 Variant 1
DNA : 274.76 KbNT_026437
mRNA : 3202 bp NM_021136
CDS : 2331 bp NP_066959
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  363 bp
gcgtaataacaggattgggaatagcgaagcagcggcggcagcagcgagtggagtaggagg
aggagcgcaggcagcggccgcggcggggccggaggaagaggaggggggagaaggaggagc
tgaagcgggaagagcggcaggcagcggctcggcggagttgcagcagaggcggcggcgacg
CTGAGACACCGCAGCTTCCCTGAGCGCCGAGTCCCTCCGGGGACAGCAGCAGGGAGCGCC
CGCGCAGCCACCGAGCCTCTGCCCAGCCAAGCCGCCGTCGCCGCGCCGGGGGACCGCCAG
CCATGGCCGCGCCGGGGGATCCGCAGGACGAGCTGCTGCCGCTGGCCGGCCCCGGGTCCC
AGTGGCTCAGGCACCGGGGGGAGGGGGAGAACGAAGCGGTGACGCCGAAAGGGGCCACGC
CGGCGCCGCAGGCTGGGGAGCCCAGCCCGGGGTTGGGCGCCAGGGCCCGGGAAGCGGCGT
CGCGGGAAGCCGGCTCGGGCCCCGCCCGGCAGTCGCCCGTTGCCATGGAAACTGCATCCA
CAG
gtaaggcgggcgccgctgcccctcaaatggcgtcggggaccagggccccccagtcagtcc
ccttctgcgcggctctcctgggcacctgcctcgcgctttctgccttgagcgccgacccca
cccccgcgtcgccacgggcgactgggaatattcgcgggctggtagaaaacaacaatttta
EXON 2  774 bp
ctatcggggagattaggaaatttaacatgctggtgctctgagggagctccgagggaactc
cgagggcttaaggagaaaggatgtcatgtcttcaccaggcaggggtgggtggtgggttag
acaagagagagagctgacgccaagcacccactcactgtctgctgctgctttgattcatag
GTGTGGCAGGTGTTTCCAGTGCCATGGACCACACCTTCTCAACAACATCAAAAGATGGGG
AAGGATCGTGTTACACATCTCTCATTTCTGACATCTGCTATCCACCTCAGGAGGATTCTA
CATATTTTACTGGAATTCTTCAGAAGGAAAATGGCCACGTCACCATTTCAGAGAGCCCTG
AGGAGCTGGGTACACCCGGCCCCTCCTTACCAGATGTGCCTGGGATAGAGTCTCGTGGCT
TATTTAGTTCTGATTCTGGAATAGAGATGACTCCTGCAGAGTCCACGGAAGTGAACAAGA
TCTTAGCAGACCCTCTGGACCAGATGAAAGCAGAGGCCTATAAATACATTGACATAACCA
GACCCGAGGAGGTGAAGCACCAAGAACAACATCACCCCGAGCTGGAAGATAAAGACTTGG
ACTTTAAGAATAAAGACACTGACATCTCAATTAAACCTGAAGGAGTCCGTGAACCTGACA
AACCAGCTCCTGTGGAGGGAAAAATCATCAAGGACCATTTATTGGAAGAATCCACATTTG
CTCCATACATAGATGATCTCTCTGAAGAACAGCGCAGGGCTCCTCAGATCACCACCCCTG
TCAAAATCACACTGACGGAAATAGAACCTTCTGTTGAAACCACTACCCAAGAGAAGACCC
CTGAGAAGCAAGATATATGTCTAAAGCCAAGTCCTGACACAGTCCCCACTGTCACTGTCT
CGGAGCCTGAAGACGACAGCCCAGGATCTATCACCCCTCCATCTTCTGGAACAG
gtaaaggccctgttattgcttgacttaggaaaacccagcatatggaaatctcaatcccta
aaacaaatattaaggaatgacaattttcattcaacatactttactatctggaccccttaa
atttcatttagtttaactaatttaattaatattcaaagttttcaatttgttgctgattgt
EXON 3  750 bp
ggcctgtctttccagcatagccctggaaacagattatttttgtgctaatgagatatgtgt
ttctcaagcaacgacaaaacatctcgcctaatggaattttgttttatccctcctctctct
gtccatctgtctgtccgtgtgtgtgcctccgtggctctccttcgctctgtgggacgacag
AACCATCTGCTGCAGAATCCCAGGGGAAAGGCAGCATCTCCGAGGATGAGCTGATCACCG
CCATCAAAGAAGCAAAGGGATTATCGTATGAAACCGCCGAGAACCCACGGCCGGTGGGCC
AGCTGGCCGACAGGCCCGAGGTCAAGGCCAGGTCCGGACCGCCAACCATCCCCAGCCCCC
TGGACCACGAGGCCAGCAGCGCGGAGTCGGGGGACTCAGAGATCGAGCTGGTGTCCGAGG
ACCCCATGGCCGCGGAGGACGCGCTGCCCTCAGGCTATGTGAGCTTTGGCCACGTGGGCG
GCCCGCCGCCCTCGCCCGCCTCGCCATCCATCCAGTACAGCATCCTGAGGGAGGAGCGCG
AGGCCGAGCTGGACAGCGAGCTCATCATCGAGTCGTGCGACGCCTCCTCGGCCTCGGAGG
AGAGCCCCAAGCGGGAGCAGGACTCACCCCCGATGAAGCCCAGCGCCCTGGATGCCATCC
GGGAGGAGACTGGCGTCCGGGCCGAGGAGCGTGCGCCAAGCCGGCGGGGCCTGGCCGAGC
CGGGTTCCTTCCTCGACTACCCCTCAACTGAGCCCCAGCCTGGCCCCGAGCTGCCCCCTG
GAGACGGAGCCCTGGAGCCTGAGACGCCCATGTTGCCACGGAAGCCTGAAGAAGACTCGA
GTTCCAACCAAAGTCCTGCGGCCACAAAGGGCCCTGGGCCTCTAGGTCCTGGCGCCCCGC
CCCCACTGCTGTTTCTCAATAAGCAAAAAG
gtaaaggatcccaagcagggatgcttggttagtgtcctccctctgggtgctctgagcatt
cagcaggggcggttctggctcagccctggagtcatccccatgctgatcaaacagttgacc
agagaacggttccaggggggatgggaggagatgagagaattcagatctgcagctgggaca
EXON 4  208 bp
caaaccaaagtggaatgacagtaagtgcccttggcacagccatctgtctgctcacttgtg
tttaggaatccagatgccaggtgagaacccacagcaaccacagcttggtggagtgagcca
cagcggctcatgtggcggcactgcgggagctcagctgggtgtgtttggtgtctcctgcag
CTATTGACCTGTTGTATTGGCGGGACATCAAGCAGACGGGCATCGTGTTTGGGAGTTTCC
TGCTGCTGCTCTTCTCCCTGACCCAGTTCAGCGTGGTGAGCGTCGTGGCCTACCTGGCCC
TGGCCGCACTCTCAGCCACCATCAGTTTCCGCATCTACAAGTCTGTTTTACAAGCAGTGC
AGAAAACCGACGAAGGCCACCCTTTCAA
gtgagtgcctcagctgaggagccctcacccactgaccaggggcttttaccctcacctgta
tttcagctcacagatgcacttgagtcatgtttctctgagacccaacagacctcttagagt
ctcccctaacaccctgtctttgaatatctaacatttctggtgaatttctgaaacaaactc
EXON 5  139 bp
tgcatggaagcaggtgtgtacggtgccctgtggccctcactggctggcataaccccccag
agatgactcctgctctcaccctcagagtgagagtaggaacgcttagctgttactggggtt
cggcagcctgtctcatgattccctctgacggaattttctgtgggaatggtttgttgacag
GGCCTACTTGGAGCTTGAGATCACCCTTTCTCAGGAGCAGATTCAGAAGTACACGGACTG
CCTGCAGTTCTACGTGAACAGCACACTTAAGGAACTGAGGAGGCTCTTCCTTGTCCAGGA
CCTGGTGGATTCCTTAAAA
gtatagttgcttaagctgttcacttcacagtcttgactgttattttccctaaaggtgtaa
tactgtaaactgctacatcaagaagaataaaaagcaagtgctaattatattctagagtca
gaagacctccagttgtatggcaccatgaaccagtctaatcccttcattgtaccaatgatg
EXON 6  70 bp
gagaactaaggactggatcctctttcattgattctgtgatgagctttcaacgcctttcat
tgactatcgaaatcatgatgtattctgactcaaattcaaatctaggtaaaagtcaatgat
atgagactctaacttgtcaggaagggttttaggagctctaataatgctttcgttcttcag
TTTGCAGTCCTGATGTGGCTCCTGACCTACGTTGGCGCTCTCTTCAATGGCCTGACCCTG
CTGCTCATGG
gtaagagcagataagactgtatacgtcttccttcaccccctctgtgaaaacgctgcttcc
taggctgtaagctttttgtttgtttaaagagattcctaggaacaaatgccagatatccct
gagtgcagagcacttctcttaccatcatagttcaattaaagagtataatatatattatac
EXON 7  47 bp
ctgtcatcttttatctagaatgctggatattgcttctcaaaatagggaataaaaaataaa
ataaaatgctgtatattccaaataatgctataatatcatataaccatataaaaatgtgtc
tataagcgtattcttattgataactcagaattttaatactatatttgtttttcatcccag
CTGTGGTTTCAATGTTTACTCTACCTGTAGTGTATGTTAAGCACCAG
gtaagttctatgtgatgtcaaaaaatggcattgaattttgacctcatcatctttggatat
gctcattattttttttttctttatgtaggcacagattgaccaatatctgggacttgtgag
gactcacataaatgctgttgtggcaaagtaagtcacatagtgcaatgcataaaaggagag
EXON 8  59 bp
attgataactcagaattttaatactatatttgtttttcatcccagctgtggtttcaatgt
ttactctacctgtagtgtatgttaagcaccaggtaagttctatgtgatgtcaaaaaatgg
cattgaattttgacctcatcatctttggatatgctcattattttttttttctttatgtag
GCACAGATTGACCAATATCTGGGACTTGTGAGGACTCACATAAATGCTGTTGTGGCAAA
gtaagtcacatagtgcaatgcataaaaggagagactctcttacatcagcatttgagtgga
ttaggataggggtaatgagaagatagtaaaatgatagattgatttatggtcattcactta
ctggaatcatatattcattctcttctcaattatgttattttagaaaataagcataagttt
EXON 9  792 bp
agtttttacttccttcttattgctttatagaagagtatttgcagatgtacttacataaag
actataatatcttctggaatattaagttctttggtcacttagctaattaaagcaacaaca
cataaaatgatttcattaataacacttgtgatttactaccttttgatactgtctttttag
GATTCAGGCTAAAATCCCAGGCGCTAAGAGGCATGCTGAGTAAACTGATTTCCCACCGGG
GACTGGACACAAACAGGAATGTCTGGAGTGGTAACAGCTCTCTTCTTACTCATTACTGCA
AATTGATTGTCTTTCCCCCCTCCCTCCAGTACCATAATCTTAGAGACAAACCTTAAAACA
GCTGTTTTTAGGCTGTTCCTTGTACTCTTAGGATATTTGAGTCACTTGTGTCAACCACTA
AAGTATAGAGAAAAGTGTATTAGATGTGGTTTTTAATTTTGTGTTGCTAAAAAAAGTGCA
TGATGGTGAGAGCCCAAGTTATCTTTCCCTCTTCGGTGTTCTTCTTCTCTTCTCTGCAAT
GCTTCTGTAGCTTCTAATGTTCCCCGTGGCTAGGCCTTTCCTGCCGAGTGCTCTGATGCA
ATAGTGGAAATCGCTTATATGTCCTTGGGTTGCTGGTTGGATTAATCTTTAATAACAATA
TATAGAATTGTAGACTGATGTTTTAGCATTTTTCCAACACACACAACGTAAAAATAAAAG
CAGTCGACCGCACTTATGGTAATCAGTTTTGTATAACTTAAAATAATTAAATAAATGAAT
AAATCCAAAACAAACATGCAGTACTTTTGTTGTATGGGATTGGTGGGCTGATTTACATGT
ATGGTTACTAAAAAGTACCAGCATGTTAACTTTATTACAATTTGTATTACTTTCTCTGTA
GTTCCTAATGGATTCAATTACGGACTCTGGATATTTGCACTTATGTACTTGATACTGAAT
GCATAAATAAAT
gttactaaatgtagaatgttctccctctcttctcatgcatggtcttaccagaaaacacaa
aagctcgaagtgatgaagtcactcgatgacattctaggagggctgagagcaaatgctcac
cttatttctctctaggactgtggagtcaaactgcaacctggcttacggtttttctgggtc