Gene RIPK3 Variant 1
DNA : 3.65 KbNT_026437
mRNA : 1557 bp NM_006871
CDS : 1557 bp NP_006862
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  20 bp
ttgttcagtcaactcggaaaaagggtaacaacccggaaagtagactcaccgtcttggtct
agagactgacccctgcacagacagaccccttcccctctctgcgaaaggaccaagccccag
aagtcactccatctcctacggctcgcaatttccagaggccccctggcaccttccagcctg
ATGTCGTGCGTCAAGTTATG
gtgagtagggagtggcatgtcgatcgcagcctccgacattcacacccagagagccccaca
gactcgctcagagaacgtctttgagtccggggacggtgggggccggcgagggaggctggg
gattgcagtgagaacgccgagtcacaggggcgcggggagcagcgctgaggcacggcacgg
EXON 2  141 bp
cctccgacattcacacccagagagccccacagactcgctcagagaacgtctttgagtccg
gggacggtgggggccggcgagggaggctggggattgcagtgagaacgccgagtcacaggg
gcgcggggagcagcgctgaggcacggcacggccggctagtgggcgacacccctctctcag
GCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACCAGGAGCTCGT
CGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGT
GGCGGTCAAGATCGTAAACTC
gtgagtgaccccggttgaccccagccgcaatctggccaaaaaggtggagccactgtgctc
tggggcctgaatggcgaagggagggattttcccacgaccccggtgcgactccagctctct
cctggagtgtaggaaggcgatatccagggaggtcaaggccatggcaagtctggataacga
EXON 3  310 bp
gcaacataggaagtggggctacgatgtggcggtcaagatcgtaaactcgtgagtgacccc
ggttgaccccagccgcaatctggccaaaaaggtggagccactgtgctctggggcctgaat
ggcgaagggagggattttcccacgaccccggtgcgactccagctctctcctggagtgtag
GAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCG
CCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGAC
TAAATTCATGGAGAACGGCTCCTTGTCGGGGCTGCTGCAGTCCCAGTGCCCTCGGCCCTG
GCCGCTCCTTTGCCGCCTGCTGAAAGAAGTGGTGCTTGGGATGTTTTACCTGCACGACCA
GAACCCGGTGCTCCTGCACCGGGACCTCAAGCCATCCAACGTCCTGCTGGACCCAGAGCT
GCACGTCAAG
gtcagctggtctacacccctctcagcctcaagacaaggccccagagctgctccagccagg
cccgccggacactagacctccagagccctgtctattgaataggcgtagcctctctctctg
gacacagggctgccaggggacaaagcccagccaggagttttagctcctgcctaccaggtg
EXON 4  146 bp
cagaccttgacctagccctaccacaaggcacctagatctaccatccaagggaacctcttc
ccttgacctccacactccctttacaaagctgaacctgcaccttctgggggcaggggggtt
cctggaggctctctggcccccttgtcttccctacctcccacttctttccttcctttgcag
CTGGCAGATTTTGGCCTGTCCACATTTCAGGGAGGCTCACAGTCAGGGACAGGGTCCGGG
GAGCCAGGGGGCACCCTGGGCTACTTGGCCCCAGAACTGTTTGTTAACGTAAACCGGAAG
GCCTCCACAGCCAGTGACGTCTACAG
gtaaggatcccggcccaaacacacagccaggattcctacacttctctgggccctcccagg
ggatgatgtataggaaaggagtcttgccagtgattggaccgatcctcagctttgtgtctc
ctgcagcttcgggatcctaatgtgggcagtgcttgctggaagagaagttgagtgtaagac
EXON 5  47 bp
agaactgtttgttaacgtaaaccggaaggcctccacagccagtgacgtctacaggtaagg
atcccggcccaaacacacagccaggattcctacacttctctgggccctcccaggggatga
tgtataggaaaggagtcttgccagtgattggaccgatcctcagctttgtgtctcctgcag
CTTCGGGATCCTAATGTGGGCAGTGCTTGCTGGAAGAGAAGTTGAGT
gtaagactctaggaggattctgggatccttaaccccaggtgcccttctcttgaaagcccc
aaggcttccccttcccgctcacctacttagactgccctcctccctcctcgtgcccccaca
ttacactccctgcctctttccatgatgaagcagataattcccttttaccctgaatgcctt
EXON 6  168 bp
ttaaccccaggtgcccttctcttgaaagccccaaggcttccccttcccgctcacctactt
agactgccctcctccctcctcgtgcccccacattacactccctgcctctttccatgatga
agcagataattcccttttaccctgaatgccttctcttctcaccctcctcccctactccag
TGCCAACCGAACCATCACTCGTGTACGAAGCAGTGTGCAACAGGCAGAACCGGCCTTCAT
TGGCTGAGCTGCCCCAAGCCGGGCCTGAGACTCCCGGCTTAGAAGGACTGAAGGAGCTAA
TGCAGCTCTGCTGGAGCAGTGAGCCCAAGGACAGACCCTCCTTCCAGG
gtgagctggccagttagctggatctaggataagcttgggtctgtcagcagggggcttttc
tcaggaaaagaagatttgctcacctgcactccactctgctgtccctctagaatgcctacc
aaaaactgatgaagtcttccagatggtggagaacaatatgaatgctgctgtctccacggt
EXON 7  68 bp
ttagaaggactgaaggagctaatgcagctctgctggagcagtgagcccaaggacagaccc
tccttccagggtgagctggccagttagctggatctaggataagcttgggtctgtcagcag
ggggcttttctcaggaaaagaagatttgctcacctgcactccactctgctgtccctctag
AATGCCTACCAAAAACTGATGAAGTCTTCCAGATGGTGGAGAACAATATGAATGCTGCTG
TCTCCACG
gtgagtgccaacatcacccctccccaggagctggtcagggatggcacagcgtggctacct
ggccatccaatgactcaccactgaccactgctttttatgccttgacctttgtacccaccg
tccccagcccacccctgagttcccagacaacagattatggaccgagagactactcccttg
EXON 8  375 bp
ctacctggccatccaatgactcaccactgaccactgctttttatgccttgacctttgtac
ccaccgtccccagcccacccctgagttcccagacaacagattatggaccgagagactact
cccttgggtttactctggctcatccaagtcatacccagcaaactcctcccatccctgcag
GTAAAGGATTTCCTGTCTCAGCTCAGGAGCAGCAATAGGAGATTTTCTATCCCAGAGTCA
GGCCAAGGAGGGACAGAAATGGATGGCTTTAGGAGAACCATAGAAAACCAGCACTCTCGT
AATGATGTCATGGTTTCTGAGTGGCTAAACAAACTGAATCTAGAGGAGCCTCCCAGCTCT
GTTCCTAAAAAATGCCCGAGCCTTACCAAGAGGAGCAGGGCACAAGAGGAGCAGGTTCCA
CAAGCCTGGACAGCAGGCACATCTTCAGATTCGATGGCCCAACCTCCCCAGACTCCAGAG
ACCTCAACTTTCAGAAACCAGATGCCCAGCCCTACCTCAACTGGAACACCAAGTCCTGGA
CCCCGAGGGAATCAG
gtgagacattgacaggattaggggatgcactaagagtcctataaatgctgtccccttgcc
agcgaaaacttggggctgagaggagtgcagtgggagtgccaggctccagggcagaactgg
atgctctgtgctgtttgcagggggctgagagacaaggcatgaactggtcctgcaggaccc
EXON 9  61 bp
ctcaactggaacaccaagtcctggaccccgagggaatcaggtgagacattgacaggatta
ggggatgcactaagagtcctataaatgctgtccccttgccagcgaaaacttggggctgag
aggagtgcagtgggagtgccaggctccagggcagaactggatgctctgtgctgtttgcag
GGGGCTGAGAGACAAGGCATGAACTGGTCCTGCAGGACCCCGGAGCCAAATCCAGTAACA
G
gtacccattctctacctctttcttttccctgttcaattcttccaccagactcctcctcca
gacctatatctagattcagggtactttgtggaggggaggggagaagatgatctaactcaa
ccttctcatttcataaatgggaaaaccgacaccccctgagaaaggagccctctgaggtca
EXON 10  221 bp
caattgccactctctagagcttctgctaacacaattctggagaggagctctgaggggagg
agcacagggcacaccttgacacagccactgacaagtagagacttcatactccccacccac
ccccaacttggcctttctgacagctaaaccctcctgccaccatcactatttctcttaaag
GGCGACCGCTCGTTAACATATACAACTGCTCTGGGGTGCAAGTTGGAGACAACAACTACT
TGACTATGCAACAGACAACTGCCTTGCCCACATGGGGCTTGGCACCTTCGGGCAAGGGGA
GGGGCTTGCAGCACCCCCCACCAGTAGGTTCGCAAGAAGGCCCTAAAGATCCTGAAGCCT
GGAGCAGGCCACAGGGTTGGTATAATCATAGCGGGAAATAA
agcaccttccaagcttgcctccaagagttacgagttaaggaagagtgccaccccttgagg
cccctgacttccttctagggcagtctggcctgcccacaaactgactttgtgacctgtccc
ccaggagtcaataaacatgatggaatgctagtcagtctgagctcagccaggggcagggag