Gene PSME2 Variant 1
DNA : 3.28 KbNT_026437
mRNA : 829 bp NM_002818
CDS : 720 bp NP_002809
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  113 bp
cccacttaccctagcccctccctcgggcagcccctggactgtgacccagccagcaccgcc
tctcctagtggcaactggctgggaatggctgaggggctacctactgcttgcggcctgcca
gcgggaggaggggggcggaaagaagaaagggggcggggttgaggggggcgggcctggacc
TGGGGAGTGAAAGCGAAAGCCCGGGCGACTAGCCGGGAGACCAGAGATCTAGCGACTGAA
GCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAAGCCCGCAAACAG
gtaatggggaatcggaggccaggaaggggtcatagaaccctcttgggtggaggccaagct
gggtggttcaggggaccaagcagtgccagagaactcccccaatctcgctagtgccttcac
ttctcggggattcccagattcctgccttctgactgcagtgagcaggagcttccagggaaa
EXON 2  33 bp
ccttcacttctcggggattcccagattcctgccttctgactgcagtgagcaggagcttcc
agggaaagctagtttgtggtgagaaaggcctgagccacagttcgagggcaccctgttgtg
ggtggaagcttttgacaacccagacccttaaccaacatccgggtactgctctctgtgtag
GTGGAGGTCTTCAGACAGAATCTTTTCCAGGAG
gtaagtctctggatttgagcgatttgacccagaatcttggaccaatacttgaggataaca
gcctctcagaatgacccccccaagtcaccctagacttaaccctacttcccttaccaagcc
ttcacccaaagtaaccccggaattattgatagctacctttaatctgacctttcttatgac
EXON 3  63 bp
cagtcctaaccttcgttctgccatttaccagcttgggcaagtcctttcattttcaggtct
tcagtttcctcatttgcaagtcttggacccagtgatttccaaaggcccttccagttccat
ttgtcagacatctcattgagcatattctgtgattcccctcccttgcaatgtaacccacag
GCTGAGGAATTCCTCTACAGATTCTTGCCACAGAAAATCATATACCTGAATCAGCTCTTG
CAA
gtgagtagtgtgggccccttctgccccatcctatgtcctctatcccctttgcccaccctc
tctagctaacaactggattcagcatgcagagaatagtttcaaatagtggattaggaacat
taggatggcgtgaggcatgagcctaggttgggaggcagagtgcaagtgggatgtatggag
EXON 4  87 bp
gctaacaactggattcagcatgcagagaatagtttcaaatagtggattaggaacattagg
atggcgtgaggcatgagcctaggttgggaggcagagtgcaagtgggatgtatggagggaa
ggctgtgacctaggatgaagggaagaggttgggcagcccttgacagtgagctctgtgcag
GAGGACTCCCTCAATGTGGCTGACTTGACTTCCCTCCGGGCCCCACTGGACATCCCCATC
CCAGACCCTCCACCCAAGGATGATGAG
gtgaggcactcagggtgcaggacttggactataaacccaatggagaagatagcccttcaa
cctctgtgacttttctaaagctactttcccccctttttgccttagatggaaacagataag
caggagaagaaagaaggtaagagagataagaggtgactagggaaggggtgatggcacact
EXON 5  31 bp
aatgtggctgacttgacttccctccgggccccactggacatccccatcccagaccctcca
cccaaggatgatgaggtgaggcactcagggtgcaggacttggactataaacccaatggag
aagatagcccttcaacctctgtgacttttctaaagctactttcccccctttttgccttag
ATGGAAACAGATAAGCAGGAGAAGAAAGAAG
gtaagagagataagaggtgactagggaaggggtgatggcacactgactactggatgagaa
agggcctgaatcccctctttctcacagtccataagtgtggatttctccctgggaatgaga
aagtcctgtccctgcttgccctggttaagccagaagtctggactctcaaagagaaatgca
EXON 6  98 bp
agaagatagcccttcaacctctgtgacttttctaaagctactttcccccctttttgcctt
agatggaaacagataagcaggagaagaaagaaggtaagagagataagaggtgactaggga
aggggtgatggcacactgactactggatgagaaagggcctgaatcccctctttctcacag
TCCATAAGTGTGGATTTCTCCCTGGGAATGAGAAAGTCCTGTCCCTGCTTGCCCTGGTTA
AGCCAGAAGTCTGGACTCTCAAAGAGAAATGCATTCTG
gtaagcctgggaaatgggggaagcagaaagagaagacacacaaggtgaggccctggactc
ctccgtagatacaagtccttcatacagagacctagtcctgaaaaagaaaacttccttctg
tgccttgggcttagatcccctttgttctcctcgttctgttagacctctcttatcacaacg
EXON 7  69 bp
gggtacaataaatacatatctctgaaggttgctgtgatgattacatgaaataaatacatg
gcacagtacctggtatgtaataagtacccaattaaatataactttttttaggaagtgaca
gtaataggaagaactcagtatgtttgttgaatgattcttacatgatacctcttaacacag
GTGATTACATGGATCCAACACCTGATCCCCAAGATTGAAGATGGAAATGATTTTGGGGTA
GCAATCCAG
gtaagaaaagggtaactgaagatacttagagtggggagagcctcagggggtgagctagac
atgaaccaggaggaggaggaagatagtgtatgaaatggggaggacatgaagtgttgtctt
tgcctcccgtgtcaccacaggagaaggtgctggagagggtgaatgccgtcaagaccaaag
EXON 8  68 bp
caagattgaagatggaaatgattttggggtagcaatccaggtaagaaaagggtaactgaa
gatacttagagtggggagagcctcagggggtgagctagacatgaaccaggaggaggagga
agatagtgtatgaaatggggaggacatgaagtgttgtctttgcctcccgtgtcaccacag
GAGAAGGTGCTGGAGAGGGTGAATGCCGTCAAGACCAAAGTGGAAGCTTTCCAGACAACC
ATTTCCAA
gtgagggcagctggaggaccagcattgggggcagtaggagcatttctttgggacccccag
agctgggcagccctatcaggatgatgggagactttgggaagggtctgagggagtacatct
ccctgaacactcattcctgtggtattcccttgcttctggcaggtacttctcagaacgtgg
EXON 9  55 bp
ccagacaaccatttccaagtgagggcagctggaggaccagcattgggggcagtaggagca
tttctttgggacccccagagctgggcagccctatcaggatgatgggagactttgggaagg
gtctgagggagtacatctccctgaacactcattcctgtggtattcccttgcttctggcag
GTACTTCTCAGAACGTGGGGATGCTGTGGCCAAGGCCTCCAAGGAGACTCATGTA
gtgagtggatagtccaccagccttttagctgggtgtgggacgaggaggtgtggaggaaga
agtcctccttgtcttgtttgtgactttcccaatgtggagaatattaagctaaaagcatta
cctagaaaaactggtttgggcttcaacaaccttgacccttttctctgctcagtcctttgg
EXON 10  87 bp
agaaaaactggtttgggcttcaacaaccttgacccttttctctgctcagtcctttgggat
cctatttcttggtgctaagaaggggttcattctcaagttaacctatttcctataaaagga
aaccagactcatgtcccagcctcccatgggactgactcagctttgcctcccacattgcag
ATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAGGCAGCCTATGGGGAGCTCAGGGCC
ATGGTGCTGGACCTGAGGGCCTTCTAT
gtgagtgtggagtaaggctttaggggaggtggatgagtgggggcaggcaggggattggct
aagaacctgactcttgcactctggccttctcccaggctgagctttatcatatcatcagca
gcaacctggagaaaattgtcaacccaaagggtgaagaaaagccatctatgtactgaaccc
EXON 11  125 bp
ggattaccgggccttggtgcatgagcgagatgaggcagcctatggggagctcagggccat
ggtgctggacctgagggccttctatgtgagtgtggagtaaggctttaggggaggtggatg
agtgggggcaggcaggggattggctaagaacctgactcttgcactctggccttctcccag
GCTGAGCTTTATCATATCATCAGCAGCAACCTGGAGAAAATTGTCAACCCAAAGGGTGAA
GAAAAGCCATCTATGTACTGAACCCGGGACTAGAAGGAAAATAAATGATCTATATGTTGT
GTGGA
ttcccttctggcgtgtgtcattcattcaaaaagcatttattgagtggcacctatgtccag
cctgaagatgaatgtggtgggaaggggtgggtgtcacaaagacaaagatgacttagatgc
ccactgtaatcttgactgtgagaaagaggggattcaggccctttctcatccagtagtcaa