Gene PSMB5 Variant 1
DNA : 9.05 KbNT_026437
mRNA : 1049 bp NM_002797
CDS : 792 bp NP_002788
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  217 bp
gccatctatttccccgacccccttcagtgaaaatggtctttcgcatctggcccttctttt
tggaggcgtgcttgccagcagtcaaaatggctccattccggaatagatttaataggaagt
gaagctgtgacggcgaggcgttgcccggcctatctttgctaggcgttctcagaattagtt
CTTTCTGCCCACACTAGACATGGCGCTTGCCAGCGTGTTGGAGAGACCGCTACCGGTGAA
CCAGCGCGGGTTTTTCGGACTTGGGGGTCGTGCAGATCTGCTGGATCTAGGTCCAGGGAG
TCTCAGTGATGGTCTGAGCCTGGCCGCGCCAGGCTGGGGTGTCCCAGAAGAGCCAGGAAT
CGAAATGCTTCATGGAACAACCACCCTGGCCTTCAAG
gtgtggagccagcccccttgccaggctgagtactgaacgcccgcgacttgcctggcctcc
cagcctgaccggagtttgcggtggccttggccaccaacccaggcggaggctgggtcctct
cgttcggaccgcagcagttttgctgtctcattggcccaggaggcccctgtctttgctctg
EXON 2  307 bp
caagggattgatgtgaagctcgggtgacattaatatatggtgaagtatagaagtatactg
tgaagtataaaaggacggagaaagagatgtgctgggtttggattgatgcaaaaagaagta
tgtaggagtgtttttgtggtcttatgtggcctgttttgtgttttcctctgatcttaacag
TTCCGCCATGGAGTCATAGTTGCAGCTGACTCCAGGGCTACAGCGGGTGCTTACATTGCC
TCCCAGACGGTGAAGAAGGTGATAGAGATCAACCCATACCTGCTAGGCACCATGGCTGGG
GGCGCAGCGGATTGCAGCTTCTGGGAACGGCTGTTGGCTCGGCAATGTCGAATCTATGAG
CTTCGAAATAAGGAACGCATCTCTGTAGCAGCTGCCTCCAAACTGCTTGCCAACATGGTG
TATCAGTACAAAGGCATGGGGCTGTCCATGGGCACCATGATCTGTGGCTGGGATAAGAGA
GGCCCTG
gtgagttaagctgcaaccacatgatccttgggctgacactacagtgaggaggggttggat
ggacagatgaattaaagggcttggtgtcaatgctgaagaagtgtaattaggtccttagcc
cttccttctctctttttttttttcctgtttttttagactgtgtctcattctgtcgctcag
EXON 3  525 bp
atcactttaacccaggaggcggaggttgtggtgagccgagattgcgccattgcactctag
cttgggcaacaagagcaaaactccatctcaaaaaaaaagaactactgccttggcatatga
attagatatcaaaaggggtgatctttttttttttcctgctaacctcatctccctttccag
GCCTCTACTACGTGGACAGTGAAGGGAACCGGATTTCAGGGGCCACCTTCTCTGTAGGTT
CTGGCTCTGTGTATGCATATGGGGTCATGGATCGGGGCTATTCCTATGACCTGGAAGTGG
AGCAGGCCTATGATCTGGCCCGTCGAGCCATCTACCAAGCCACCTACAGAGATGCCTACT
CAGGAGGTGCAGTCAACCTCTACCACGTGCGGGAGGATGGCTGGATCCGAGTCTCCAGTG
ACAATGTGGCTGATCTACATGAGAAGTATAGTGGCTCTACCCCCTGAAAGAGGGTGGATG
CAGCTGCTTGTGTTTCTTGGGGTGACTGTCATTGGTAATACGGACACAGTGACCCATCCT
CCATCCTATTTATAGTGGAAGGGCCTTCAATTGTATCAGTACTTTTTTTTAAGCTCTGGC
ACATTGACCTCTATGTGTTACCAGTCATTAATGAGCTGCTGCAGAGGTGACTATTTGTTT
TACTTTCTTGGATGTTAACATTACACTACTCACTACTCAATCTCA
gcctgtgttgcatcttttgtccacactgtccctcctccaagcacttttcagtcaaataag
ccaggacagtggaagggaagtgactgtaattacaggaaacagtggtgtgaagacattgtc
tagtgaatacattaatgtccccactcatgaagctaataacggagaaggagagagaggcag