Gene PSMA3 Variant 1
DNA : 27.13 KbNT_026437
mRNA : 927 bp NM_002788
CDS : 768 bp NP_002779
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  67 bp
cctccattgcttctgcacatgcgcgccgccagcctctcgcggcccgcttttttcccacaa
tactcctcgtcctgggggccggagccgcggaacgagccacagagaaaaaggttattggtt
ggcagttcagccaatgagcgggcctgttactagtttgcggcatcctgtggtataggggaa
GCGCTCCGGGCCTGGAATCCCTACGCGTCCCTTTGGGTTTAGCACGATGAGCTCAATCGG
CACTGGG
gtgagttcgctgtctgtcggtgtaatagtttaacctaaggattggggttgaagggaactc
ggacagaccacatggggttcgcggacccggggtgctctgagaccgccttcggctgggtgg
gccatttgcagctgtttggagaccggtcgtctttatcccctatatgctaggcctgcgtct
EXON 2  83 bp
ggtatatagctttatcttagctactgttgctgctctgacaagtttccctttcctctcttg
aaagcaaggtctttgttgggatataacaggttcctgatgtttcagccatttagaggggaa
gaaactgtatggtcattactgccaaagatacaagcttactgttgcccttttctccttaag
TATGACCTGTCAGCCTCTACATTCTCTCCTGACGGAAGAGTTTTTCAAGTTGAATATGCT
ATGAAGGCTGTGGAAAATAGTAG
gtaagaaacatttaaccaggtattacatgtctccttttattttatatatttttggcgatt
aggctttgttatgttactttggtacaaattagtatatgtccccaaatctcaatttattca
tttccagatctctttctaggccagatgctttccatgagccccagtcctatatttctcgtt
EXON 3  124 bp
tatttatatggatttaatgtatttattacactttagtgtgttttctcttcctggttttca
aatgttttaaggtatttggcatgccttaaatgttacttattttgtttttttgttaaactt
aagtttatgaagtttcttttattttcagttaaaaaactgattttcttctccttgtttcag
TACAGCTATTGGAATCAGATGCAAAGATGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCT
TTCTAAACTTTATGAAGAAGGTTCCAACAAAAGACTTTTTAATGTTGATCGGCATGTTGG
AATG
gtaaggtcatgtttaaaatgttcctttttgtcttgtccaatttcttttgaagtaactgat
tggaatagatcactgtgcagtcacaaaagtaatcagagcaagttactgcatttgtccagt
tcactgtccagtagaaaggcagcattctcataaccttattagtgatgggggaaaaaccaa
EXON 4  102 bp
ttctaaattataatttcatactcaagcatcaaaatgccttgtagagagacctttaagcca
aaaaagtttattttgaatggtaatacttgttaaaaaaatgtttaataagtctttattaat
tgcagactttgatttgtgataggaatgtgttcctctagtaaattggtgcttttttttcag
GCAGTAGCAGGTTTGTTGGCAGATGCTCGTTCTTTAGCAGACATAGCAAGAGAAGAAGCT
TCCAACTTCAGATCTAACTTTGGCTACAACATTCCACTAAAA
gtaagttgataacatattgaggaaccttttggacagtaatagaagtttattaataagctc
ttctgcttccctccatagcatcttgcagacagagtggccatgtatgtgcatgcatataca
ctctacagtgctgttagaccttttggctgcaggtaagaaattttgtgaattattcaaaag
EXON 5  74 bp
gcagtagcaggtttgttggcagatgctcgttctttagcagacatagcaagagaagaagct
tccaacttcagatctaactttggctacaacattccactaaaagtaagttgataacatatt
gaggaaccttttggacagtaatagaagtttattaataagctcttctgcttccctccatag
CATCTTGCAGACAGAGTGGCCATGTATGTGCATGCATATACACTCTACAGTGCTGTTAGA
CCTTTTGGCTGCAG
gtaagaaattttgtgaattattcaaaaggcagatctgtactatagatatttattatgttc
cccagcatcttagccttttacatacttaaaaatagaaactcgtcgataagtattagggca
atgattaaataaaacagtgtacatagaaactacttgaggctgggtgccatggctcaagcc
EXON 6  73 bp
tgaataatctcatgtaatagttttaattaattgaaaccactgtttcaaagtacttactga
gttatatgtgtattagtaatttatctcagaaagaaaatataactgcattttaaaataatt
ttttcacaaatacttttatgttattgccatggtttaagctgtttgtatactttcatgcag
TTTCATGTTAGGGTCTTACAGTGTGAATGACGGTGCGCAACTCTACATGATTGACCCATC
AGGTGTTTCATAC
gtgagtaattttgaatcatttgaaattctattttagtttaatggtatttcattagcattt
aagtctcattataagattatatgaaattaaaaaaaaactcattcaaggaaagtaattttt
cttttttttttttttacaacaacctcttgtccaacagaatttttttttttttcctttttg
EXON 7  66 bp
tggtattttagtatttttgagccctttggcattcatcagaatgtgtttgactatattttt
ctatacttgcttttaaaagtcatttagcatcctttcactaggttatagaaacattagtag
tcattaattacatatgatagtgtactaattcagtgattatatatatttttttctaaatag
GGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGCAAGCTGCAAAGACGGAAATAGAGAAG
CTTCAG
gtaataattaatgcttgaatttttactatgtcgtcatcctaatgcagtgaaattttatca
ccacagacatttcagtctaaggcagggatgtccaatcatttggcttccctgggccacaca
taaaatacaccaacactaatgatagctgatgagcttaaaaaaaaatctcatcatgtgtta
EXON 8  47 bp
acccagcctggagtataaatttcaaaacattaaaatatgaatcaggaaacttcgattctg
gtctttttcagactttaggttattttccttggttttatatctgagtataaaagtgaaaat
agttattacacaagtggaaaatgttcttctgatgaacagtatacattttattttctatag
ATGAAAGAAATGACCTGCCGTGATATCGTTAAAGAAGTTGCAAAAAT
gtaagttgaaatttttcttaccatccacaaaaatatttcatttgacctttgcatatatat
attacattaatcctaagaagctgttttcctgtaaaataacttagtgtataatttttagaa
ggtaaatttaacattctaagaagcctcacgaaggaagaaaatgtttttaagcaatatttt
EXON 9  68 bp
tatttcagtccctgtgtaatttgtcttctctaatgttaaatactatgtagaatgtgtctg
tgtaattttatagatacttttattatggatggacattctaatttgtactgactttgggtc
tgtgaactacttcaatgtttggaggttaccaaaatcttacctttcccttttctattctag
AATTTACATAGTACATGACGAAGTTAAGGATAAAGCTTTTGAACTAGAACTCAGCTGGGT
TGGTGAAT
gtaagttatttttgtacatttatttgccttaggaatgatctgtaccacagctaatttaca
actgagtgtcctttctaatataatgaaagctaaagcaaatttactaggttgtctaatgaa
gggaaagttctgcttaataattgacttaagttgtgaacacgttattttttgaaacatcca
EXON 10  65 bp
tgtaggcacatataatctcatgtagaagcagcacacaaaaatattcgagtattactcata
gtacaactttgcaaccttaggtgagtcagatatgtggattgggtagatcctatggtatac
tgcaagttacaatatggtactcaatttaaaattcatttacacatgtggcttaatttacag
TAACTAATGGAAGACATGAAATTGTTCCAAAAGATATAAGAGAAGAAGCAGAGAAATATG
CTAAG
gtaagccacagcacaaaaacttctcttggccaggtacagtcagggaatcacttagcccag
gagtttgagaccagcctgagcagcacagcaagacccccatccctaatttaaaaaaaaaaa
aattctctaaccaaaattatgtgttgaataatataaatagactggggtggtttctatgaa
EXON 11  158 bp
atgttagagcaacatttgcttaattaactttgcttgggtatcttattctgaaactgttca
ttcagttacaagtagaggaatttaaccacttaattcaggttgttgtagcttaacttgccc
acaggtgtgggatataacaattttaaaaatcaattttaaacacctgttttctcttaacag
GAATCTCTGAAGGAAGAAGATGAATCAGATGATGATAATATGTAACATTTACTCCAGCAT
CTATTGTATTTTAAATTTCTACTCCAGTCCAATGTAACTATTTAGCCCTGGATTATACAT
ACTGTCCAATTTTCATTAAATTTTTGTCTTATAACTAT
tgaagtttggttaatatctgctttacaaaattggtgggggtaaatgaggacatttactca
gtattaaaatatagatttatgactactgaaaaattccctggttaaaatgctgcagaatta
attccaagactgtagattaattcaaagccccatcttcatcactcaactagaatttacaga