Gene PPM1A Variant 3
DNA : 37.36 KbNT_026437
mRNA : 2373 bp NM_177951
CDS : 975 bp NP_808820
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  331 bp
gaggggtgggggaggggcgacgcggtcgtgagcgcgcctgcgcggggccgcgctagaggc
ggcggcggcggcggtggcggcgctagggacgggagcgcgcgcgggagctagagagcagtg
gtctcggcgctcgtccggcccgcagcttcgggtcctcaggcggctgttgctccggaacgg
GTGGTTGGGGAGGGGGGGGTGGGGGGACTCTAGACAGCTGAGGCGCGAAAGCGATGAGTC
CTCGGCTCTTCCTCCTCCTTCTCCGGGACCCGCTCTCTGCCTCCCTCTCCAACGCCCGGA
TGATCTGAGCCGCGAGGGCGCCGACAGCCGGGGGCCCGGACGCAGCCCGGCTCCTCCCCT
CCTCCGCCCCTTCCCCAGCCTGACCTGGCCCGCCGCTGCAGCGGTGACCCCTCCCCCGGC
TGCCGCCGTCGCCGCCGCGGTGACCCCCTCCCCGGCTGCCGCCGCCGCCGCCTCGGCCGA
CCAGGGACCTGCCCGCCTGCGGCTGCTCCGG
gtaagtgcggcgctcgggccgacggcgggctggcgggcggtgcgggcctgcgcggcggcg
gcggcgggcaggcctggggcctgtaaacaagccgggcgtctgcccgggcgctcccgggag
gagacgcgacaactccaccccctggccggcctcctcccccgagccgggcggcggacggcg
EXON 2  102 bp
gggctgagagactccttcagaactcaagtcagtgagtgatgcctctagttcattcattat
taaggcatcgaacaaatccattgaagtaaattccgatttcttatccttttaactacgtaa
atcgggtaaaacttcttgatgttagagcttggttgaggtatggttctgttctgcttgtag
ATTTTAAATAAACTTGGAGCCTTTTCTTGAAAGACAGCTGGCTGTGGAGAGCCTTCTACC
AACTGCAGTTTTAGATACGTTTTGAAAATTTCATCACCTGAG
gtatttttcttctctcctgaaacaccacatggtacaaatccacaaaagtcatgcttcagt
tgtccaagccatgggatctgtgtgctagccccacctccccgcaagtttcctgctcattgg
aataatgagctgaatgtgttttaagaagtggttggaagagtatgagagataggtatcatt
EXON 3  854 bp
tcaggctttcccccagttcctccttgttaatctccagattccaagtcagcaacacaatga
atgtctgcttatcgcgagttgtgaattcccgcatatctctttcacttattaaaaagattg
tttggtacatattttgtttataagacagttattgactttcctgtttctcttcctttgcag
ACCTAGAGGATCAAGACATAATGGGAGCATTTTTAGACAAGCCAAAGATGGAAAAGCATA
ATGCCCAGGGGCAGGGTAATGGGTTGCGATATGGGCTAAGCAGCATGCAAGGCTGGCGTG
TTGAAATGGAGGATGCACATACGGCTGTGATCGGTTTGCCAAGTGGACTTGAATCGTGGT
CATTCTTTGCTGTGTATGATGGGCATGCTGGTTCTCAGGTTGCCAAATACTGCTGTGAGC
ATTTGTTAGATCACATCACCAATAACCAGGATTTTAAAGGGTCTGCAGGAGCACCTTCTG
TGGAAAATGTAAAGAATGGAATCAGAACAGGTTTTCTGGAGATTGATGAACACATGAGAG
TTATGTCAGAGAAGAAACATGGTGCAGATAGAAGTGGGTCAACAGCTGTAGGTGTCTTAA
TTTCTCCCCAACATACTTATTTCATTAACTGTGGAGACTCAAGAGGTTTACTTTGTAGGA
ACAGGAAAGTTCATTTCTTCACACAAGATCACAAACCAAGTAATCCGCTGGAGAAAGAAC
GAATTCAGAATGCAGGTGGCTCTGTAATGATTCAGCGTGTGAATGGCTCTCTGGCTGTAT
CGAGGGCCCTTGGGGATTTTGATTACAAATGTGTCCATGGAAAAGGTCCTACTGAGCAGC
TTGTCTCACCAGAGCCTGAAGTCCATGATATTGAAAGATCTGAAGAAGATGATCAGTTCA
TTATCCTTGCATGTGATGGTATCTGGGATGTTATGGGAAATGAAGAGCTCTGTGATTTTG
TAAGATCCAGACTTGAAGTCACTGATGACCTTGAGAAAGTTTGCAATGAAGTAGTCGACA
CCTGTTTGTATAAG
gtagctagactttttttaaaaacataaaatgattttatgccatattaatcactactctag
tatttaatcatcttagaatctgtaattctgaaaccagtttttggcacaactgtaggatac
tgttcaccaattatgaaaatatatcataggaccactatgtagaaataaattacccaatta
EXON 4  1086 bp
gggagggggagtcattgcacacacacacgcacgcatgcgtgcacatatgtatttttttct
ccctgaaagtaacattttcactagaacaagtataactgtaattggcacagctgtaaaggt
tctcaaggctttgaagagcaaaaagaaaactaaaatattctcaaatttttttcttcccag
GGAAGTCGAGACAACATGAGTGTGATTTTGATCTGTTTTCCAAATGCACCCAAAGTATCG
CCAGAAGCAGTGAAGAAGGAGGCAGAGTTGGACAAGTACCTGGAATGCAGAGTAGAAGGT
GGATCATTTAACAAAAAATAAGTAGCTTTATTAAAGAAAAATCTTCAACACAATCAAACT
TTAACATTTTAGCTTTTAGATTTTTATGTGTCTTTGACAGCTAGTGTCTAGTGTATGAAA
GTGGAAAAGGACATTTCTGTAGTAGCTGTTAAGATGTATGCAGTTGTCCTATCACAGTTA
TATTAGAAATAACAACTAGTGTGGAAAGTAACCCACATTCTGTTCAGGATACTTTTGTTT
TAAAAGGCTAAAATGTTTGTGTGCTTTAAAATTCTTAATGAATTCACTGGCATGAGTAAT
TTTATGCCGGGAAAATCTGATTTGTGGTCTATTTAATTACAAAGAGATTGTGATGGTGAT
AATTTGAATACCATCTTTCTATGAAAAGCTGTGTATATTAATTTTAATCTCTAGGGCCTT
TTTTCAATAACTTGAAAATCACAGCCTCATCATTAGCAACTTTATATACACAGCTTTAAA
AAATTTGCTTTAAACTGTTTCAGAGCTTCTTCCCTAAGCCATAAACTGTCTCACCTAAAC
AAGATAGACCTCAATAAAAGACATAATATTTCTCCACCTGGCAGAAAAGTAACTGCCAAG
TAAGATTAAGAAATAAGTTGAGCATTTCTGGAGTATATTTCTCATAATTCTGCAGAGACT
TCCAGTTTATTGCATATATGCAGTAAAGTGTATATATTATGCAGTTTCTCTAAGTGGAAA
AACTTGACATGACTTTAATAGTGTTAAAACATGAAAATGCTGGTGAGCTGAGGTAGAAAA
AAAACAAGAAAAAAATTTTAAAAATAGCGTTAAAATGCATTTTAGGCTCCTAATGTCGTT
AATTTGCACGTTAAAGACCTCTAATCGCATGCAAGCATTGACCTACCACACCTACATCCC
ACTGTGCCTGCATTATTGAAATTACTACTCACTTTAATTTTTTTTCCCCTTTTTACTGTT
TGATAC
caatcataatcagtctgatactagaatcatgattggttttgttctttagtactgtctaga
gctactattttgtttttattgctgtccgccacttgatagtcatacatctagtatgtgttt
gtactatttagtattgcattcattggacgtactattcaacgaatttgtctccttactgtt