Gene PPM1A Variant 1
DNA : 47.60 KbNT_026437
mRNA : 2334 bp NM_177952
CDS : 0 bp
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  295 bp
tggtgctcacagttgcccaggtttctctcaggtcgcaggatgagccacagtggtagcata
agactgctggctgctcccctctgcccctccctaatggggctgcccagtgatgtcacacag
gacaggattctctaatccttttgattctgtaacagtcctctaagcagctaagtttctcat
AATGTATTATGATGTAGGGGAGGGAGGAAGGAGGGCCAGGGTAGGGGGCACACCCTCTCC
CTGAATGAAATTCATTTAGGGGCACTGTCTGCTCGCATGTTCTGTTCTGGGAGAAAATGG
GTAGCAGAAGCTACAATTTGTACTAAGCTAATGAAAAGAGAGAAAAGAAGAATGGGGAAG
AGAAGGGCAAAGAAGGCAAAAAGAGAAGAGAAGAAAAAGGGAGGAGAGAGAAGGAGAAAT
GAGAAAAGAGGAAACCAAATGAAGAGGATGTGTGAGAGAAAAAAATATGAAACAG
gtagtgagggaggaaggaattgttgaacctatgttctggttggctttctaactcttgagt
agtgactggcttcagtggaaaaggatggtgaggggtattctcaaatactagcctcctgag
ggggtcatttacattactgcatatattttgagaggcccaggcaagtctgcctcaagggtg
EXON 2  854 bp
tcaggctttcccccagttcctccttgttaatctccagattccaagtcagcaacacaatga
atgtctgcttatcgcgagttgtgaattcccgcatatctctttcacttattaaaaagattg
tttggtacatattttgtttataagacagttattgactttcctgtttctcttcctttgcag
ACCTAGAGGATCAAGACATAATGGGAGCATTTTTAGACAAGCCAAAGATGGAAAAGCATA
ATGCCCAGGGGCAGGGTAATGGGTTGCGATATGGGCTAAGCAGCATGCAAGGCTGGCGTG
TTGAAATGGAGGATGCACATACGGCTGTGATCGGTTTGCCAAGTGGACTTGAATCGTGGT
CATTCTTTGCTGTGTATGATGGGCATGCTGGTTCTCAGGTTGCCAAATACTGCTGTGAGC
ATTTGTTAGATCACATCACCAATAACCAGGATTTTAAAGGGTCTGCAGGAGCACCTTCTG
TGGAAAATGTAAAGAATGGAATCAGAACAGGTTTTCTGGAGATTGATGAACACATGAGAG
TTATGTCAGAGAAGAAACATGGTGCAGATAGAAGTGGGTCAACAGCTGTAGGTGTCTTAA
TTTCTCCCCAACATACTTATTTCATTAACTGTGGAGACTCAAGAGGTTTACTTTGTAGGA
ACAGGAAAGTTCATTTCTTCACACAAGATCACAAACCAAGTAATCCGCTGGAGAAAGAAC
GAATTCAGAATGCAGGTGGCTCTGTAATGATTCAGCGTGTGAATGGCTCTCTGGCTGTAT
CGAGGGCCCTTGGGGATTTTGATTACAAATGTGTCCATGGAAAAGGTCCTACTGAGCAGC
TTGTCTCACCAGAGCCTGAAGTCCATGATATTGAAAGATCTGAAGAAGATGATCAGTTCA
TTATCCTTGCATGTGATGGTATCTGGGATGTTATGGGAAATGAAGAGCTCTGTGATTTTG
TAAGATCCAGACTTGAAGTCACTGATGACCTTGAGAAAGTTTGCAATGAAGTAGTCGACA
CCTGTTTGTATAAG
gtagctagactttttttaaaaacataaaatgattttatgccatattaatcactactctag
tatttaatcatcttagaatctgtaattctgaaaccagtttttggcacaactgtaggatac
tgttcaccaattatgaaaatatatcataggaccactatgtagaaataaattacccaatta
EXON 3  118 bp
gggagggggagtcattgcacacacacacgcacgcatgcgtgcacatatgtatttttttct
ccctgaaagtaacattttcactagaacaagtataactgtaattggcacagctgtaaaggt
tctcaaggctttgaagagcaaaaagaaaactaaaatattctcaaatttttttcttcccag
GGAAGTCGAGACAACATGAGTGTGATTTTGATCTGTTTTCCAAATGCACCCAAAGTATCG
CCAGAAGCAGTGAAGAAGGAGGCAGAGTTGGACAAGTACCTGGAATGCAGAGTAGAAG
gtggatcatttaacaaaaaataagtagctttattaaagaaaaatcttcaacacaatcaaa
ctttaacattttagcttttagatttttatgtgtctttgacagctagtgtctagtgtatga
aagtggaaaaggacatttctgtagtagctgttaagatgtatgcagttgtcctatcacagt
EXON 4  109 bp
cattttttgtcataaatcttcaaaggtcaacctgattttttttttttttaaatgatacca
gattagaaaaatctcagatgtggtaaatgccatctttaaaaagctaggttatctttgttt
cggttttcttttcaattaaatttggataacacttacaaaaaaagtacttctgattcccag
AAATCATAAAGAAGCAGGGGGAAGGCGTCCCCGACTTAGTCCATGTGATGCGCACATTAG
CGAGTGAGAACATCCCCAGCCTCCCACCAGGGGGTGAATTGGCAAGCAA
gtaagttacattctgtacactcttatgctttatgtcagtgtatgaaaatgttaggtattc
attgataaaatgtttgtttgcctaatttctgaactgatgcagttatctgtgttttaacct
gtgatttcaatttttttttagtattagaatatctagagtttgtttagacataggtatcag
EXON 5  58 bp
ctttaacataggagcccaaatatcttaaaagtgaggctcactattgacagcaagaaatag
aactaaaataatatctgagtataagattatcttagaaattttaataaacacctggctatg
agttactaagcaatgttttgctttctgaagaattaattttctgcatttttttacacttag
GAGGAATGTTATTGAAGCCGTTTACAATAGACTGAATCCTTACAAAAATGACGACACT
gtaagtagcattttagctccctctgctttcccttcccctccactctaaatgcatatcctt
cctacctgtttttgcagagctgttcactgtacccattctcttacacacacccctgattga
ttgctctgaactctgcttgctctgatctctgcctgcaccacagttctagtgattgaggac
EXON 6  900 bp
gaacagattaaacattgctatttcatatgtacacatatatacttatatactttaaaaaac
atttatattctaaaagtcatctttacagaacattatctttctccattatccagaaagtat
ggtgtattttggcaccgctaaattttaacgttgttccttattttgcttccttttacaaag
GACTCTACATCAACAGATGATATGTGGTAAAACTGCTCATCTAGCCATGGAGTTTACCTT
CACCTCCAAAGGAGAGTACAGCTCAACTTTGTTGAAACTTTTAACATCCATCCTCAACTT
TAAGGAAGGGGATATGACATGGGTGAGAATGATTACATCAGAGAACTTCAGCAGTACAAC
AGCTAGCCCAGAACTGATTTTTTTTTTTTTTTTTGTAAATTTGAGACTTATGTAAGCGTG
ATTTCAAACCATAATTCGTGTTGTAAATCAGACTCCAGCAATTTTTGTTGTATGATTTTG
TTTTTTTGTAAAGTGTAATTGTCCTTGTACAAAATGCTCATATTTAATTATGAACTGCTT
TAAATCACTATCAAAGTTACAAGAAATGTTTGGCTTATTGTGTGATGCAACAGATATATA
GCCCTTTCAAGTCATGTTGTGTTTGGACTTGGGGTTGGAACAGGGAGAGCAGCAGCCATG
TCAGCTACACGCTCAAATGTGCAGATGATTATGGAAAATAACCTCAAAATCTTACAAAGC
TGAACATCCAAGGAGTTATTGAAAACTATCTTAAATGTTCTTGGTAGGGGAGTTGGCATT
GTTGATAAAGCCAGTCCCTTCATTTAACTGTCTTTCAGGATGTTCCTTCGTTGTTTCCAT
GAGTATTGCAGGTAATAATACAGTGTATTCATAAGAATCTCAATCTTGGGGCTAAATGCC
TTGTTTCTTTGCACCTCTTTTCAAGTCCTTACATTTAATTACTAATTGATAAGCAGCAGC
TTCCTACATATAGTAGGAAACTGCCACATTTTTGCTATCATGATTGGCTGGGCCTGCTGC
TGTTCCTAGTAAGATATTCTGAATTCCATTTTATCAATAAAGCTTGATTTAACAAACAAG

aaacttaatcatgtatgtgtaattcctcttttaccctggccttttaaaacactgtgccgt
tgtaatgagacgtttctcatagggaaagatgttagtctcttttaattggacaacactgtc
actcaaggcatagatgaaactttccttccattagaaagactaaaagatttaattcttggt