Gene NFKBIA Variant 1
DNA : 3.23 KbNT_026437
mRNA : 1550 bp NM_020529
CDS : 954 bp NP_065390
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  321 bp
ctccgatgaaccccagctcagggtttaggcttctttttccccctagcagaggacgaagcc
agttctctttttctggtctgactggcttggaaattccccgagcctgaccccgccccagag
aaatccccagccagcgtttatagggcgccgcggcggcgctgcagagcccacagcagtccg
TGCCGCCGTCCCGCCCGCCAGCGCCCCAGCGAGGAAGCAGCGCGCAGCCCGCGGCCCAGC
GCACCCGCAGCAGCGCCCGCAGCTCGTCCGCGCCATGTTCCAGGCGGCCGAGCGCCCCCA
GGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTGAAGAAGGAGCGGCTACTGGACGACCG
CCACGACAGCGGCCTGGACTCCATGAAAGACGAGGAGTACGAGCAGATGGTCAAGGAGCT
GCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCGCGCGGCTCGGAGCCCTGGAAGCAGCA
GCTCACCGAGGACGGGGACTC
gtaagtggcggaggcccggggctgggggtcgtcgggagggcgggacgcgcgcggcctggg
ggtgggaggcgccgggcctggagcccgagccgggggaccagcgatgcagccgggcgggcg
ccgcggcaccccggggctcctgcaccgccccgaacgctgcagggctgcagggccgcgcgg
EXON 2  109 bp
gggggcggaaagtccctgggcgcctgccaggaacactcagctcataataacctcgcggaa
aacaccgcggcctcggcctccagaaaccccggccttgcgcaatcccccgcagcccgcgcc
tccctgggccccacgcggtgcactcaccacccctggggtttttccctctcttccccacag
GTTCCTGCACTTGGCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCA
GGTGAAGGGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAG
gtgcgccgcttgcctggcccgggttctctctgaccctgggacgtagctgatgtagcagag
tcaccccagatcctttctgaattcagggccactgagcactatttaccctcaccttttact
tcacatcagcccacatcctagagagtgaaggaaattccactgatttggtgaggtctttat
EXON 3  211 bp
ggaaattccactgatttggtgaggtctttatgacccacctggagcctctgctatttgcca
gccctccccacccccctgtctaggaggagcagcacccaaccaggagacacgggttgaggg
gaactcggggtgtgggtttggtccatggcttactttctctggtctctcttgcattcgtag
ACTCCACTCCACTTGGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGA
GCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAATACCCCCCTACACCTTGCCTGT
GAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGACTCAGTCCTGCACCACCCCGCACCTC
CACTCCATCCTGAAGGCTACCAACTACAATG
gtatgtctgcctccctgccctgccccaccccctcggagggcaggtgacgtggagaagggg
caggtgggccaacttaaggagtccaggcaagagcttaaactcctaacatttggaaggttg
agaaaatatgtgtgcaaagtgcctattggatgcctttataaagttctttcagaacccaga
EXON 4  89 bp
tggaaggttgagaaaatatgtgtgcaaagtgcctattggatgcctttataaagttctttc
agaacccagactgtgggttcttaaaattcagaagataagactacttgttccataaaagaa
taggtgaaaggagtgagggttgaaacaggtggttatacttttttccttttgttcttccag
GCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGG
TGTCCTTGGGTGCTGATGTCAATGCTCAG
gttggtgcttcctgcccccgacgcactgagtcaggctcctcgtgcttatgttgtgagcag
aaattccaaatgcagccataagcatctcaaattccttttggtttcaggagccctgtaatg
gccggactgcccttcacctcgcagtggacctgcaaaatcctgacctggtgtcactcctgt
EXON 5  270 bp
cttagcctctatccatggctacctgggcatcgtggagcttttggtgtccttgggtgctga
tgtcaatgctcaggttggtgcttcctgcccccgacgcactgagtcaggctcctcgtgctt
atgttgtgagcagaaattccaaatgcagccataagcatctcaaattccttttggtttcag
GAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTG
GTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGAGTTACCTACCAGGGCTATTCT
CCCTACCAGCTCACCTGGGGCCGCCCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTG
ACACTAGAAAACCTTCAGATGCTGCCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAG
TCAGAGTTCACGGAGTTCACAGAGGACGAG
gtgagtctgtgaactccttcggcgctctaactaatgaggtgccattcccttcaccctccc
aggcccctagagctgctccttatcagaggggtatctacataatgagtctctcaaatttct
gtgcataaccagtatcccaagaatgtacctgccccccctctttttttaaagagaagcatt
EXON 6  550 bp
ccccctctttttttaaagagaagcattaaaggcaaactctctcagcctgtaaagttcatt
atatttgggctatggagaatggagtccaagagttatttccagtagtggcctccccatccc
ggtagcttggcagagctccgctccggaagcttaacgtgtcttttttccccttgttttcag
CTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTATGAGCGCAAAGGGGC
TGAAAGAACATGGACTTGTATATTTGTACAAAAAAAAAGTTTTATTTTTCTAAAAAAAGA
AAAAAGAAGAAAAAATTTAAAGGGTGTACTTATATCCACACTGCACACTGCCTGGCCCAA
AACGTCTTATTGTGGTAGGATCAGCCCTCATTTTGTTGCTTTTGTGAACTTTTTGTAGGG
GACGAGAAAGATCATTGAAATTCTGAGAAAACTTCTTTTAAACCTCACCTTTGTGGGGTT
TTTGGAGAAGGTTATCAAAAATTTCATGGAAGGACCACATTTTATATTTATTGTGCTTCG
AGTGACTGACCCCAGTGGTATCCTGTGACATGTAACAGCCAGGAGTGTTAAGCGTTCAGT
GATGTGGGGTGAAAAGTTACTACCTGTCAAGGTTTGTGTTACCCTCCTGTAAATGGTGTA
CATAATGTATTGTTGGTAATTATTTTGGTACTTTTATGATGTATATTTATTAAACAGATT
TTTACAAATG
agttatcctgatcattttcttcaggctgccgtgggcctccggttctgaagttccatcctc
cggcagaggtggaggtggagcagtgtgagggaggaggtaactcccagcagcttctcacac
ctgacacccagcctccagcaaagctttgcaggcaccctgggcccagtgtgtgggagggag