Gene MPP5 Variant 1
DNA : 41.36 KbNT_026437
mRNA : 2572 bp NM_022474
CDS : 1512 bp NP_071919
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  114 bp
tggttcaaagaaatgttctctgaaaatgcatgttgaattaatactgaaacagttaatttt
tggataccttttcttcttctactagaaatagaagacttgttttcttcacttaaacatatc
caacatactttggtagattctcagagccaggaggatatttcactgcttttacaacttgtt
CAAAATAAGGATTTCCAGAATGCATTTAAGATACACAATGCCATCACAGTACACATGAAC
AAGGCCAGTCCTCCATTTCCTCTTATCTCCAACGCACAAGATCTTGCTCAAGAG
gtatgtattctaaacatcttgttgatgtctacaaggtaattagtagtggcaggaaggcag
gattattggaaaatactaatgtgactataagatttgtttgaattaattactgttaattac
atgttaataatgtattgtgacagtttactacatgcattttatcctaaaaacaaaaaaagt
EXON 2  78 bp
aatactgttgttttatccataataacaagattgaaaactctaataattctttttagtgat
tttatttcttacaagtatttttattattttaatttgtacttaaaaaatatgaccctgcat
acaggtgctactgatacttcctataatctaggaagaataatctttatttttgtttcttag
GTACAAACTGTTTTGAAGCCAGTTCATCATAAGGAAGGACAAGAACTAACTGCTTTGCTG
AATACTCCACATATTCAG
gtagaaaatggacagaatactatatatgtggtttttccagcattcttctatttttttaaa
tcaaagactccagtactggaagagatgtcaaacattctctagcctattttgatgtttaca
accccatctataacatagtagttattgttggattatatattttcagatttaaaatgaacc
EXON 3  147 bp
tttcataacccattccagagtatgcccttagtatacttaacacatctttattattagctc
taattaattataacacttttaaagatttaatggtcagaatactatgtacataggttaaaa
atcactctgcagaaataaatcatgctgttacttaaaatgccatggatttctttgaaacag
GCACTTTTACTGGCCCACGATAAGGTTGCTGAGCAGGAAATGCAGCTAGAGCCCATTACA
GATGAGAGAGTTTATGAAAGTATTGGCCAGTATGGAGGAGAAACTGTAAAAATAGTTCGT
ATAGAAAAGGCTCGTGATATTCCGTTG
gtaagtgtcccacatactgtttttaaacaagtgcatttttctgctgttgtgtgcttcaaa
agtctggttaatttcagaattctaatgaatagagtatttctgaagcagaaagtgtggggg
aaatggtcaacttttaaatctaattacaattactctagttgtgtaaataaattttttctt
EXON 4  162 bp
gtgtgggggaaatggtcaacttttaaatctaattacaattactctagttgtgtaaataaa
ttttttcttaagataactgaaggttagtattgttgaatggaaaaaatagaatttaaaaat
aaatgcttaacaaaaattgtattatttttatttttaaattatacatatatatatttttag
GGTGCTACAGTTCGTAATGAAATGGACTCTGTCATCATTAGCCGGATAGTAAAAGGGGGT
GCTGCAGAGAAAAGTGGTCTGTTGCATGAAGGAGATGAAGTTCTAGAGATTAATGGCATT
GAAATTCGGGGGAAAGATGTCAATGAGGTTTTTGACTTGTTG
gtaagttgacgcagctagaagaataattgatagcttttagaaagctcttattagacttta
gaataaaatatttttaaaataactgttaagagcactagatgatttctagcctgatttttc
catgatgtaactgttccacagtatttgttagcagttttatttttgggtggtaccactgat
EXON 5  78 bp
tcttcacacacttattttcatccagccccattcattgctttggtagagcaaagtgctgct
ggtcatttaagtctgtggaggggttctgaaatagtccagtttagggaatatagatcataa
aatcatggaatgattttcataaatgcaaatttaaaaaataacctgatctttctattacag
TCTGATATGCATGGTACTTTGACTTTTGTCCTGATTCCCAGTCAACAGATCAAGCCGCCT
CCTGCCAAGGAAACAGTA
gtaagtgatttttaaatgttcattatttatgtgtttgtggatgctgtttacttctgttac
tgtttactgttacagaaatgtcactgtttcctgtactcaaataaattcaatcatttttat
ttaaataaatatgaaatatcaatgttttaaattagtaaactctgcacctttttttttgga
EXON 6  184 bp
ggagaaggatcgcttgaggctagaaatttgagattatcctggacaacatactgagatgct
gtctctattaaatttttttaaaattaaaaaataataaaaaatttgtagcatttaaattgt
attcatatgaaacattttatattgccatttattgttgtttttgccctttttatcttttag
ATCCATGTAAAAGCTCATTTTGACTATGACCCCTCAGATGACCCTTATGTTCCATGTCGA
GAGTTAGGTCTGTCTTTTCAAAAAGGTGATATACTTCATGTGATCAGTCAAGAAGATCCA
AACTGGTGGCAGGCCTACAGGGAAGGGGACGAAGATAATCAACCTCTAGCCGGGCTTGTT
CCAG
gtaagacacaatatggtagaaagtacataatattaaaagaacattgaaaatgcaagcctt
cacaaagaaaaactcactctttcatgcctctatttaataaagtattccagttactttttc
gtgtagttgggtttttatgttgtacctgcagcgtaagtatattaaatagaatgtggccaa
EXON 7  72 bp
atattttaaaaatttggaggcttacacatcatagctgacattactcctgtgttggcaaaa
ggatttggaagggaatataagtgaagagatatgtctagtgttttcccttcttgattaaaa
aaaaaattcttatccttttatcttaaatattttacccttctttttctttctgctattaag
GGAAAAGCTTTCAGCAGCAAAGGGAAGCCATGAAACAAACCATAGAAGAAGATAAGGAGC
CAGAAAAATCAG
gttagacacttgtatttgacataagtaaatggtttcttgggtcttcatctggagccatgt
gtgaatctgcatattagaaccgtgaagaagtactcagggaaagagtgatacaagaggcaa
aactgattatctcagaactgtaaagaaaggataagatttaagtattaaagattatctgtc
EXON 8  72 bp
tgaggcgggaggatcacttgaggccaggagttcaagacaagcgtggccaacatatggaga
tctcgtttctgcaaaaaaatttaaagaataaatgaatgaataaatagagttcttcaattt
gagttatgtggttttgttcacgggaacacatttatagttatgtttatgattgctcaacag
GAAAACTGTGGTGTGCAAAGAAGAATAAAAAGAAGAGGAAAAAGGTTTTATATAATGCCA
ATAAAAATGATG
gtaagttctactctcagggataggtggaattatatctgaaaggagtctaaacctagtcct
gttttgcaccttaatgttaaatatgtgcttgagaaaatcatttagtagaaagtattttct
tttggaatcctgtgagtaaggcagtgttttgaattctggggaaaactgatacaaaaattc
EXON 9  168 bp
ataaaaattaatagaaggagtattatattgttgtctgattcattttcatgataccctagc
aaggatgtaatgacaataaattgtgcttttgtctaattttgggtgaagatctatgagtat
ttatatctttaatacatggccataattttgtttgaagagcttaacttttttttcccaaag
ATTATGACAACGAGGAGATCTTAACCTATGAGGAAATGTCACTTTATCATCAGCCAGCAA
ATAGGAAGAGACCTATCATCTTGATTGGTCCACAGAACTGTGGCCAGAATGAATTGCGTC
AGAGGCTCATGAACAAAGAAAAGGACCGCTTTGCATCTGCAGTTCCTC
gtaagtttgaatgcattcccattttcctgtgcttttcaatttaccagctcagaacctaac
tatatcatgtagggaaattttttattcatttcattaaaacactgttgtcagtgaaagagg
aactttaaccaaagattttgacaatttttaaattaaaaatagtcattattaagaaattta
EXON 10  203 bp
gttcatttttcaatctacaaaaaataaaaacaatgttaaacatgtaggcacttagcattt
tctcagtttattattttataatctgtgttacaaaatagaaattctttctgactagcagaa
ttatcccctgtcctcactctaagccatgcctgttatttctatctgattttgtttgcctag
ATACAACCCGGAGTAGGCGAGACCAAGAAGTAGCCGGTAGAGATTACCACTTTGTTTCGC
GGCAAGCATTCGAGGCAGACATAGCAGCTGGAAAGTTCATTGAGCATGGTGAATTTGAGA
AGAATTTGTATGGAACTAGCATAGATTCTGTACGGCAAGTGATCAACTCTGGCAAAATAT
GTCTTTTAAGTCTTCGTACACAG
gtaaagctagaactttgttttagggtttgaacttagaaggaatgtcatatagagtaatct
agtggaagctatattttggtccaagaacagcgcgacctaattaagttctcatacggtttt
tcccactgatttgctatctgaaatcacacaggttgctaaatctctttcagtttcctcaga
EXON 11  111 bp
aggggccacttgagtgcagcagattgaggttgcagagagctgtgatcacaccactgcact
ctagcctaggcaacagagcaagtcccttaatctaatatatatatatatatatatatcagt
attattaggaagtaattaaatgatgcaaattattttaaaaatcaaaatgtctctttacag
TCATTGAAGACTCTCCGGAATTCAGATTTGAAACCATATATTATCTTCATTGCACCCCCT
TCACAAGAAAGACTTCGGGCATTATTGGCCAAAGAAGGCAAGAATCCAAAG
gtaaagttttcacactattgtactattccattgaaggtaaacatgaaacagtcctggtct
aatttgtcctggtgcttaaaagctacattagcttgagctttcaaactgattattttttct
gtaatattacttgcccaaaaattgccatggttgccactgggttggactatggcagctttc
EXON 12  1183 bp
agatgccaaagcaaaggtaaccattgtggccgtgacagggttggaaaggagctcctgagg
ttgggagagacagaaggaaagctatgaaggtcgctccttgttctttggccatctctgact
catcctatattatttggttaggaaaggaattatctcacagtttttatcttctgtttgcag
CCTGAAGAGTTGAGAGAAATCATTGAGAAGACAAGAGAGATGGAGCAGAACAATGGCCAC
TACTTTGATACGGCAATTGTGAATTCCGATCTTGATAAAGCCTATCAGGAATTGCTTAGG
TTAATTAACAAACTTGATACTGAACCTCAGTGGGTACCATCCACTTGGCTGAGGTGAAAG
AAACATCCATTCTGTGGCATGTTGGACTTGATCTGGCAAAAACTGCCAATAGGAGGACTG
CCCGACACTGCAGCAAGATTGAGGATAAGATGGAAGGCAGCAGTATAAGCTGTAGATCTG
TTCTTAGATCTCTTGAATTAGTGAGACGACAGTTCCCTTAGGCAGTTTGTGCATGGCATC
CTTTATTCTCTATACATGGCTTTAGCGGTTCTTGCCTCATTTTGGGATTCTAAATGGAAG
CTTTCAACAGAGCATTCCATTTTGTCCTGTTAAAACCTTTTGTTTTCACCTAAACCCTTT
CTGCTTAGTTGTATCTCTGTGAAAAACTTGTATACACAAGCGTCCATGTCTCACACAAAT
ATTGATGTGATTATTCTTAAGTGTTAAATCATTAACACTTAAATGACTTCATTGGGAATA
TTGAGCAGAGGGACTGTGCTTCTATGCACTGGGCAAGGCAGTATTTGCTTAGGAAACTAA
TTTAGTCATCAGAGATACTTTCCTAAAAAGGAAAAATAAAAAACAAAATGGTGCCACTTT
GGGTTGAAGCTACTTTGTTAGGCTTGAATTCATTTATATGTCTTTTGATTCTTAAAAAAA
CAAAAAACATTCCATTAGAAGCACCAGTTTTTTTGCTCAGACTTTGTGGATCAGACTCTA
CACTCAACACACTCTAATCTACTTAAAGGTATACAAAATATGCTGATCTTTTTTAAATTA
TGATTTCCTGAATTTTTTTCTTAAGTCGTCTCAACTGATTTACTCACTTAGCTTCCCTTC
CCTCATCAGCATAGTATAATAGAATGTATGTTACATTTTTATGAATGGCAGGTGTTCATT
ATAATCTGTATTGACTTAAAAAGTTTCTTCCTCATGATGCTAATAGTTTTTTGTATACAT
GGGAGGATAGCACATTTGACAGTTTTTGCATTTTTATGTATGAGCACAGTATCCTATGAC
TGTGCTACGTATATATAGGTAATAAACTGGAATTCTGTTGATG
aatatagctgctgtactgtatattaatatttaatagatcaacaaatggtcattgaaaaca
cttgtttagcattagaataaaattatatatgtccttgggaaatattatgacagttgactt
taagatcaaaaggaagggaagacctgaaagtcatttgaacattttaggaaaagaatattg