Gene MGAT2 Variant 1
DNA : 2.68 KbNT_026437
mRNA : 2677 bp NM_002408
CDS : 1344 bp NP_002399
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  2677 bp
cgcctttcgcagctctcgcctaacaggaaagggaagaaacaggcggaagtgggaactgca
cctgagcgacagtactgcaaaccaataggcagccggccacggcggtcaggcgccttcggt
cgcgtctggaaagcaccaaccaacggtctaaggggcgggccggaggggtgtgggccggag
GGCCGCGGTGTGCCGCGGGGCAGTTGCGGGTTGTCATAACGGTCCCCGCCGGAGTGAGGC
GAGGCCGCGTCGCTCAGTTCTGGCCGTCTAGGGCCCCTGTAAGGATGAGAGCGCAGAGGA
CGCAGGGCCGCTGGAGGCGCAGGTAACGAAGCTAGGGTGCGGTTGGGACCGCGGCTGAGC
TTTTTCCGGGACCCGTGGTGCTGAATGGAGAGGACGGAGACGAAGCCGAGCCGCGGCTCC
TAGCGGCGGCGCCGATGCTCGAGCTGTAGCTGCCAGGCGAGGATGTGTGGAGCGCAGGCG
GCGCGGGGTAAATGAGAGGTCTCGGGCCCCAGGACCCCCGGGGCCCGGGATGAGTTAGCG
AGGGCAGCCGCGGGGGCCAGTTCCGACCGTGACAGGCCAAGGCGACGGCCGCCGCCCGCC
CGCCCCTTCCGTGCAGAAGCAGCTGCTCCTTTCCGCGCCCGCCCGCCTGCGCTCCCGGCC
CTGGAGACCATGAGGTTCCGCATCTACAAACGGAAGGTGCTAATCCTGACGCTCGTGGTG
GCCGCCTGCGGCTTCGTCCTCTGGAGCAGCAATGGGCGACAAAGGAAGAACGAGGCCCTC
GCCCCACCGTTGCTGGACGCCGAACCCGCGCGGGGTGCCGGCGGCCGCGGTGGGGACCAC
CCCTCTGTGGCTGTGGGCATCCGCAGGGTCTCCAACGTGTCGGCGGCTTCCCTGGTCCCG
GCGGTCCCCCAGCCCGAGGCGGACAACCTGACGCTGCGGTACCGGTCCCTGGTGTACCAG
CTGAACTTTGATCAGACCCTGAGGAATGTAGATAAGGCTGGCACCTGGGCCCCCCGGGAG
CTGGTGCTGGTGGTCCAGGTGCATAACCGGCCCGAATACCTCAGACTGCTGCTGGACTCA
CTTCGAAAAGCCCAGGGAATTGACAACGTCCTCGTCATCTTTAGCCATGACTTCTGGTCG
ACCGAGATCAATCAGCTGATCGCCGGGGTGAATTTCTGTCCGGTTCTGCAGGTGTTCTTT
CCTTTCAGCATTCAGTTGTACCCTAACGAGTTTCCAGGTAGTGACCCTAGAGATTGTCCC
AGAGACCTGCCGAAGAATGCCGCTTTGAAATTGGGGTGCATCAATGCTGAGTATCCCGAC
TCCTTCGGCCATTATAGAGAGGCCAAATTCTCCCAGACCAAACATCACTGGTGGTGGAAG
CTGCATTTTGTGTGGGAAAGAGTGAAAATTCTTCGAGATTATGCTGGCCTTATACTTTTC
CTAGAAGAGGATCACTACTTAGCCCCAGACTTTTACCATGTCTTCAAAAAGATGTGGAAA
CTGAAGCAGCAAGAGTGCCCTGAATGTGATGTTCTCTCCCTGGGGACCTATAGTGCCAGT
CGCAGTTTCTATGGCATGGCTGACAAGGTAGATGTGAAAACTTGGAAATCCACAGAGCAC
AATATGGGTCTAGCCTTGACCCGGAATGCCTATCAGAAGCTGATCGAGTGCACAGACACT
TTCTGTACTTATGATGATTATAACTGGGACTGGACTCTTCAATACTTGACTGTATCTTGT
CTTCCAAAATTCTGGAAAGTGCTGGTTCCTCAAATTCCTAGGATCTTTCATGCTGGAGAC
TGTGGTATGCATCACAAGAAAACCTGTAGACCATCCACTCAGAGTGCCCAAATTGAGTCA
CTCTTAAATAATAACAAACAATACATGTTTCCAGAAACTCTAACTATCAGTGAAAAGTTT
ACTGTGGTAGCCATTTCCCCACCTAGAAAAAATGGAGGGTGGGGAGATATTAGGGACCAT
GAACTCTGTAAAAGTTATAGAAGACTGCAGTGAAAATCACAGTTACAAAAGCGACAGTCT
TCTATTTTTGATATTTGTCCAAACAGGACATACAATTGAATAAAAGAGTTTAGGAACTGG
TTTCTGCTTTAATACAAAAACAAAATCTTGTAAAAGGTGTCCAAATACATAGTAATCTTT
TCCAGTTATGTCTGATTAAGATTTAAAACTGAAGGTTTCATTTTGGGAGTAGGGTTTTAA
AGCTCAATCTGTTATCTGCTAAAATTGATTATTGTTGATATGAGAGAAGAGGGGAAATTT
TATTTAAATTGCATTTATTAATCTTTTTATCTGAAACTTTGTACACTTTTCCACTTTCAA
AACCTATTTTAAGTACAGCAAAATTTATTTAAAACTGTCATAGCAGTAAAAAGTATTACG
ATGAAATTGTTAGGGTATTAATGGAACAAACCCAGTTTCACTCTCTTGACACACTTATTA
GGAAGGGATTGCTTCACTGGTTTAATAATTTAAAAGTTATGTTTGTTAAACACCCTGTCA
GAACAGTCATTTTCAGTATTAGATTCCTGTACTATTGTGTTTTGAGTGTGTTTTGGAACC
TTCATAGAACACACTTTCTTTTGGAATGTATTTGATTGATAAGAAAGTTTAAACATTGTT
TTCACCTCAATGTAGAAATACAGTGGTTTTGTTTTTTTTTTTCTTTTAGTGCTGACAAAA
TAAAATACTCATTTTTGCATAAAAAGGTTCCTAATCCTTTTGCAGAATAAGTTTTGTTTA
CTCTTTATACCAAAATTCAGTGAAGGCATTCTACAAGTTTTGAGTTAGCATTACATTTTA
ATATTTACTATTGCTACATTGTATAATTGAGTTTGAA
ataaaacccagcttatgacaatgcattccctgtgcaagaaactgtttggctttcaaatta
cccaggcattgaaaatgaatgataaaaagttgctgtgtaagggaaatacagcctaaattg
tttttgaaagccagaaatgatacaaagttcagtcatgccaaagtgaaatactttctagtg