Gene MAX Variant 5
DNA : 18.76 KbNT_026437
mRNA : 896 bp NM_145114
CDS : 291 bp NP_660089
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  206 bp
gggctggcgtcgcctggatgcggtttcttccgggatttgtagtttttctggagctacccg
ggccgtctgttagagggacaagaactacaagtctcggctgccccagcgctgcgagcctgg
tcacgtggcgggggccgaccgggcgtgcgtgccgccgttgatccggtgctgcagtgagga
GGTGGTTCTTGCCCGTGTTGTGTGTGTGTGTGAGTGAGAGAGCGAGTGAGTGAGTGAGTG
AGTGTGTGTGTGGGGGGGACTCGGCTTGTTGTTGTCGGTGACTTCCCCCTCCCCTTCACC
CCTTCCCCTCCCCGCCGCCGCTGCAGTGGCCGCTCCCTGGGCCGTAGGAAATGAGCGATA
ACGATGACATCGAGGTGGAGAGCGAC
gtgagtcctggggcttcttccttcccgtgcgggttgtcaggcggggacagcggccggggc
tcttagcggggcgacggcgggagggggccgggctgccgccgcctccttccccttcccctc
ggggccaggagtgcctccgtcgcgttcccggttcgctcccctccggctcctggccggagc
EXON 2  27 bp
ctaccggatcccgccgagggtggaagggtgggggcaaggggtggggagggaggaaggggt
gtcgggctgactccccaccctccgcttcctctgccgccggcattttctttcttattattg
aatgttaagtgtaaaaataacttctatattttctatttttttttttctctcttattccag
GAAGAGCAACCGAGGTTTCAATCTGCG
gtacgtctcctactctccatttcatttttatttccgttcagttctattcctttttggggt
cagagagaaaaagagatcgtactattacttttaatattgtagtaaactctaatgttaacc
actaaggtgaggtggggcctggttctggagggtgggggggttgcaaatcccattattcta
EXON 3  108 bp
ttctccccctttagcagagcctaattctggagactcctaactgcccacctcgagaaatcc
ttcccagtccactcgccagggacagtgctgacagcgtgtacttccaggctgtaccccacc
caccttgtaccaagcaaaaggagtgacattcctaatgtgttctttctcccattcttctag
GCTGACAAACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGAC
AGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAG
gtgagtttcctgagaaagctgagtagctggccactactagcttggaacttgttgcagagc
ttagcagagcactcacctattgggaaggaaatgtagtcagagatattcaggtagcatggt
tgccttatttttgactgtttggaggatcactgcacaccttacgtactccagtttatcctt
EXON 4  555 bp
ttttttcaagcaaattctaaagagtagtcttttggtagtgttttgagagtaccagtttca
ttatcactggaatttttttttttggaagagggtaactaattcagtaaacaaaagttagta
attttgtattctatttattacttgtgaaattaattgcttttccacatgtttatttactag
CTCTATTTCCTCTTTTGGAAATTGTGTACTCCTGTCCTTCATCGTCAAAGTTTGATGCAG
AAATGCCACACCTTCATTTCAAGCTACCAAGTGCACAAGAAAAAAGAATGCAAGATTTAA
AAAATGATTGTTTTGACCCCTTACACAAATGTCTTACTCCTGGCTTTAATTAAGCTGCTT
GAGGGCTGATAGCTCTGCCTTACCCTGGTAATCAGCAAAATGGTCCTGTGGCTGGGGAGG
CCCTGGCAGCAGGAAGCCTTCAAGGAGCCATGGGTCTGTGCTGACTCTGGCCTTACAACC
TTCCAGCCTCCTTTGCTGGCATTGATGGGGTTCCATTTTTGAATGAACTAGTTTAATGTG
GATCCAAATTTATTGTGCATATTCTTTCGTTTTGGTTTTCAAAAGATGGCTTATTCACAT
GGAAATGTACACCAGTTTAGCCCTGGGCCCTCCCTTTACCTTCATATGTGTAAAAGCTTA
CACAGGTTTCAGAAAATAAATGGTTTCATTTTCTCTAAAATAACTAGTACAAAATAAAAC
AGATGTCAGTTGTTG
agtccagcagtacctcttttttcatccctccagatatggcattttggttcttaggggaac
aagacagctgtaacatcagcccactggcatctgttttgggcactgaagaggaaaagtgtt
cagtagagttaagattattgtttctcacgtcagcattgggaccctagggaagggcagtgg