Gene MAX Variant 4
DNA : 24.71 KbNT_026437
mRNA : 575 bp NM_145116
CDS : 405 bp NP_660092
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  206 bp
gggctggcgtcgcctggatgcggtttcttccgggatttgtagtttttctggagctacccg
ggccgtctgttagagggacaagaactacaagtctcggctgccccagcgctgcgagcctgg
tcacgtggcgggggccgaccgggcgtgcgtgccgccgttgatccggtgctgcagtgagga
GGTGGTTCTTGCCCGTGTTGTGTGTGTGTGTGAGTGAGAGAGCGAGTGAGTGAGTGAGTG
AGTGTGTGTGTGGGGGGGACTCGGCTTGTTGTTGTCGGTGACTTCCCCCTCCCCTTCACC
CCTTCCCCTCCCCGCCGCCGCTGCAGTGGCCGCTCCCTGGGCCGTAGGAAATGAGCGATA
ACGATGACATCGAGGTGGAGAGCGAC
gtgagtcctggggcttcttccttcccgtgcgggttgtcaggcggggacagcggccggggc
tcttagcggggcgacggcgggagggggccgggctgccgccgcctccttccccttcccctc
ggggccaggagtgcctccgtcgcgttcccggttcgctcccctccggctcctggccggagc
EXON 2  27 bp
ctaccggatcccgccgagggtggaagggtgggggcaaggggtggggagggaggaaggggt
gtcgggctgactccccaccctccgcttcctctgccgccggcattttctttcttattattg
aatgttaagtgtaaaaataacttctatattttctatttttttttttctctcttattccag
GAAGAGCAACCGAGGTTTCAATCTGCG
gtacgtctcctactctccatttcatttttatttccgttcagttctattcctttttggggt
cagagagaaaaagagatcgtactattacttttaatattgtagtaaactctaatgttaacc
actaaggtgaggtggggcctggttctggagggtgggggggttgcaaatcccattattcta
EXON 3  108 bp
ttctccccctttagcagagcctaattctggagactcctaactgcccacctcgagaaatcc
ttcccagtccactcgccagggacagtgctgacagcgtgtacttccaggctgtaccccacc
caccttgtaccaagcaaaaggagtgacattcctaatgtgttctttctcccattcttctag
GCTGACAAACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGAC
AGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAG
gtgagtttcctgagaaagctgagtagctggccactactagcttggaacttgttgcagagc
ttagcagagcactcacctattgggaaggaaatgtagtcagagatattcaggtagcatggt
tgccttatttttgactgtttggaggatcactgcacaccttacgtactccagtttatcctt
EXON 4  234 bp
aaaaataaaaaaataaataaataaataaagcctacagtagccattattgtatttcttcag
ccttttcccaccttaccctctcgtttccagccacccaagcagttgctgcaggccaggttc
cctcactgcctggattgggtttttattttgtcccctgtgctttttctcatattgccacag
GCATCCCGGGCCCAAATCCTAGACAAAGCCACAGAATATATCCAGTATATGCGAAGGAAA
AACCACACACACCAGCAAGATATTGACGACCTCAAGCGGCAGAATGCTCTTCTGGAGCAG
CAAGGTGAGCACCCGAGCTCGTGGGGCAGCTGGCCCTGCTGTGCTCCAGCCAGGTCAGGC
TTTGGCACCTGGGCCTGCAGAGTCAGAGCCAGTCATGGAGTATGTGCTCAGTAG
caggcttggtcctgcttcttggggcctgagtaactgagtgttagagccgtcctgaggaag
gacctgaggcgccagtgaggagacagtggaagctaggaagttggacatctggagacttgt
atcttttctggcctgacctctccccttcttggggctcaggtgctctgcctgcagtaggga