Gene MAX Variant 3
DNA : 27.38 KbNT_026437
mRNA : 2103 bp NM_145113
CDS : 312 bp NP_660088
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  206 bp
gggctggcgtcgcctggatgcggtttcttccgggatttgtagtttttctggagctacccg
ggccgtctgttagagggacaagaactacaagtctcggctgccccagcgctgcgagcctgg
tcacgtggcgggggccgaccgggcgtgcgtgccgccgttgatccggtgctgcagtgagga
GGTGGTTCTTGCCCGTGTTGTGTGTGTGTGTGAGTGAGAGAGCGAGTGAGTGAGTGAGTG
AGTGTGTGTGTGGGGGGGACTCGGCTTGTTGTTGTCGGTGACTTCCCCCTCCCCTTCACC
CCTTCCCCTCCCCGCCGCCGCTGCAGTGGCCGCTCCCTGGGCCGTAGGAAATGAGCGATA
ACGATGACATCGAGGTGGAGAGCGAC
gtgagtcctggggcttcttccttcccgtgcgggttgtcaggcggggacagcggccggggc
tcttagcggggcgacggcgggagggggccgggctgccgccgcctccttccccttcccctc
ggggccaggagtgcctccgtcgcgttcccggttcgctcccctccggctcctggccggagc
EXON 2  27 bp
ctaccggatcccgccgagggtggaagggtgggggcaaggggtggggagggaggaaggggt
gtcgggctgactccccaccctccgcttcctctgccgccggcattttctttcttattattg
aatgttaagtgtaaaaataacttctatattttctatttttttttttctctcttattccag
GAAGAGCAACCGAGGTTTCAATCTGCG
gtacgtctcctactctccatttcatttttatttccgttcagttctattcctttttggggt
cagagagaaaaagagatcgtactattacttttaatattgtagtaaactctaatgttaacc
actaaggtgaggtggggcctggttctggagggtgggggggttgcaaatcccattattcta
EXON 3  108 bp
ttctccccctttagcagagcctaattctggagactcctaactgcccacctcgagaaatcc
ttcccagtccactcgccagggacagtgctgacagcgtgtacttccaggctgtaccccacc
caccttgtaccaagcaaaaggagtgacattcctaatgtgttctttctcccattcttctag
GCTGACAAACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGAC
AGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAG
gtgagtttcctgagaaagctgagtagctggccactactagcttggaacttgttgcagagc
ttagcagagcactcacctattgggaaggaaatgtagtcagagatattcaggtagcatggt
tgccttatttttgactgtttggaggatcactgcacaccttacgtactccagtttatcctt
EXON 4  124 bp
aaaaataaaaaaataaataaataaataaagcctacagtagccattattgtatttcttcag
ccttttcccaccttaccctctcgtttccagccacccaagcagttgctgcaggccaggttc
cctcactgcctggattgggtttttattttgtcccctgtgctttttctcatattgccacag
GCATCCCGGGCCCAAATCCTAGACAAAGCCACAGAATATATCCAGTATATGCGAAGGAAA
AACCACACACACCAGCAAGATATTGACGACCTCAAGCGGCAGAATGCTCTTCTGGAGCAG
CAAG
gtgagcacccgagctcgtggggcagctggccctgctgtgctccagccaggtcaggctttg
gcacctgggcctgcagagtcagagccagtcatggagtatgtgctcagtagcaggcttggt
cctgcttcttggggcctgagtaactgagtgttagagccgtcctgaggaaggacctgaggc
EXON 5  101 bp
aggtgtctgaaaagagctttgaggtccttggagtggaatgtgctgtgtaagtaccagaga
ctccaggtgttcagggacagtgagccctccccattgtcaatggtagtccaatcagggcag
cctatgggctaggcccatgctgttctcaatgctcacacccgccttttcctacaaccacag
GGGAAAGCGAGAGCTGATCAAGTTCTTTGTTCCTGGGGAATTCACTTCTCTTCCTCCCTC
ATGGAAGATGCAAGTAAAAGGAAATGCAAGTAACCACCTGG
gttagaaaacctcaaataaaataaaataaaataaattaaatgggttgaccttccaggctc
aagctgagctgaaccaagggatgggcagtgggtggtgtcagtgggttggttactgggcca
ggcagcctgcatgtaggggctatttgaaaagcccaggtattttatgtgtattggtgactt
EXON 6  1537 bp
cgggagggaaatgaagtgtgtgagtgaacagccacccgaagggagctacttctgagcatc
ttgagcctcgggggccaacaagcaagcccttaggaagaacaggctggaccctgagtctga
gactcggttactccccaagtctccagaaggcagtaacacactcccttggttgccttttag
TCCGTGCACTGGAGAAGGCGAGGTCAAGTGCCCAACTGCAGACCAACTACCCCTCCTCAG
ACAACAGCCTCTACACCAACGCCAAGGGCAGCACCATCTCTGCCTTCGATGGGGGCTCGG
ACTCCAGCTCGGAGTCTGAGCCTGAAGAGCCCCAAAGCAGGAAGAAGCTCCGGATGGAGG
CCAGCTAAGCCACTCGGGGCAGGCCAGCAATAAAAACTGTCTGTCTCCATCGTCTCATCC
TCCTTTCAGTTCGTTGGTAGAGCCCTCAGAACCATTTAAGAGACTCTTTATTTTTCTCTT
TCTCCCTTTTTTTTTTAAATTTTTATTTTTACGTAGAAGCTCTTGGACAACAGCTCTCGT
TCTCCTTCCCCATTTCCACTGTATATTTTTTAATGTATTCCCTTCAGGGATTCCCTGTCC
CCAACAGGAATTTTTAAACCAAAACACCCCAACTTGGCAGCTTTTTCTGTGGAGGACAGA
CGGCCGGCCGGACCTCTGAGCACATAGTGTCCTGCCCACCCTACCAGCTCCTCCAGCCCT
GCCGGGCACATGCCCGGGGGACGCCTGCCCTGCCCAGGTGGCCTCCTGGCCCGCCCTCAC
CTCTGATAGACTTTGTGAATCTGAACTGCTCTACTTTGAGAAGATGACCGGTTTGGAGTA
ATCAGAATGAACCCTCCTCCTTTTTAAGGGTTTTTTTTTTTTCCTTTTTCTAAAAAGCTA
TGTATCGCTCCTATTGAAAGACCAGATCCTTAGAGAAGTTTGTGGTATAAAAAGGAAGTG
GGGACAGATTCGCAGCACAGAGTCGCTGGCATGTTTCACTCCTGCTTCTCTCAGCCAGCT
GTTTAAGCCTGCGGCGCCAGCCTCACGGAGGGCCGTGTGACACTCTCGTGGTATGTATGG
GAGATGGCAGCAGTGAAGCAGCAGCCACCAGGGAGTGGCCATTTGGGGTTGGGACAGGGA
GGGTGTTTTGGGTGGCATAGAGGTTTTGTATTGAGGGCCAGTGATGATGTTTTGATATTT
ATTTCCTGCTACTTAAATTTGAATCTGAGTGAATTGTACCTATTTCTGATGATGTCGGTC
TTGCAAAGCGACAGATTCATAAAGTAATGATGAAATCTTTCTTTCTTCCCGTGTGTATTT
CTAAGAAATAGAGCCAACTGATTTTGTATGTAAATACCAAGAGCAATTTACCTGGTACTA
AACCCGCACCCCAGTGCGGACCCTTCCCAGCCCTCATCCCACTTCCTTTCCTACTGTCCT
GGAACCTGTCTCCATTGTGTGATCCAGCCCTGGTTCTGGCTGTGGTCAGCAGATGCCAGT
GAAGGGTTTTGTGTGTTTAGGCCTCATTTCTTTGTCTTTTTCCTACTCCGTTCCTGGCAT
TTGCTGATTTCTAGTGTATACTCTGTAGTCTCAGTTCGTGTTTGATTCCATTCCATGGAA
ATAAAAAGTATGTTGTACATACTGCCGAAGAATTGTCTTGCAAGTTAAGGCTTCCCCCTT
TACTATAAGACTATAAATAAAAACTTATTTTATCCTT
cttggtggtggtgtcttcttacccttgttaaggccaaggtggttgatgagagacccctct
ggaagctgttagggcctcaatgtaagtctgagtgagaagtggaggtggcttacccggtct
tgcagaaccaggagcagccataagccagagttgcttcccctttctcagctcagcctgaga