Gene HECTD1 Variant 1
DNA : 107.20 KbNT_026437
mRNA : 8873 bp NM_015382
CDS : 7839 bp NP_056197
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  302 bp
cctgcgcggcctgcggcttcttgggaactctagggccgcggccgggcctggctctgccgg
cggcctgttgggagctggatcggagcggtttggaacgacaagcccgagtaagagcctgcg
ggaaggggaggcgggagcgcctcggaccgtcggaagggccctgcgtgggggcgcggatcc
CGGACGCCCGGCGAGTGGCGGAAAGCGAGACCCCGGCGCCGAGTGAGGTCGGCCAGGCTG
CTGCCGACTTCCCCGCTGGCCCCTTTGTTCCCCTCCCGGGGCCCTGCCGGCGGCGGGGCC
CGGTTGCCCGCGCCAGAGCCTCAGGCCGGCTCCTTTTGCCCTTGAGAAGGGTTCGCTGCC
AGGCCTTCGAGTTCCGGGCGCAGCTCCCGGGAGAGCCGGCGCCCTGCCTGGCCCGGCGGC
CTCCTCTCGGGCACGAAGGCTTGCTGCTGCTTCTCCAGAACTTCCCTTCCTCGTAGACAC
AG
gtagttaacttagcggggtttggtgctggggaaccacagcgcgggggccagcgcctctca
gcgcccggctcggccgggccccgggtgtggggtcaaccccgctggtcgccgccgttgggt
gcccaccgcgccccgccgccggcttcccacacttgcggctgcgttacgtgggacccaaag
EXON 2  161 bp
aaagttgaaaaactgcattaagcactcttacgtccaaacgtacttaggagtcttttttaa
ttgctaggaggacactatgaaaatttggttctagcagatgtaaaggaagaaaaatttaag
cccaagctgttcagtcccggaatttaaaggacttttctccctttacttttcaaatttaag
CAAAGAGACTTTTAAAAAACCATGGCAGATGTGGACCCAGATACATTGCTGGAATGGCTA
CAGATGGGACAGGGAGATGAAAGGGACATGCAACTAATAGCCCTTGAACAGCTATGCATG
CTGCTTTTGATGTCTGACAACGTGGATCGTTGTTTTGAAAC
gtaagtacattccttcatcatgttcctttgggttactgtagtgacatctgttttcaacca
tttgctgacttcagtttgtgtagaaatttctctagtgaattttaacacgtatctttaaaa
atattcctgaagagttttgtgtttacacttttccaagaaataaaaattggtaggtgaaga
EXON 3  235 bp
tagcatgtgagtattgttatggaagcaaaaacaatgtgagaaatattacctaataaacat
tcagacacagtattgagcacagtgtgttacattataactttttattttctattattttgt
taatattttgctgttaagaatttaataaccctagatgtaatatgatttctttcactacag
ATGTCCTCCTCGCACTTTCTTACCAGCCCTTTGCAAAATTTTTCTTGATGAAAGTGCTCC
AGACAATGTATTAGAGGTGACAGCCCGTGCCATAACATACTACCTGGATGTATCTGCGGA
ATGTACCCGAAGGATTGTTGGGGTAGATGGAGCTATAAAAGCACTTTGTAATCGTTTGGT
TGTAGTTGAACTTAACAACAGGACTAGCAGAGACTTAGCCGAACAGTGTGTAAAG
gtaagtattacttattggctcattacttatttttctcagacctctcagggatgagtattg
gctcatttaaacatcacttagagactgaaaaatgtatttactaaaaaaaaaaaatttcta
aaaaaaaaaattcttcctatcttcagtcttactttattgagagtagttgagaacagtgga
EXON 4  228 bp
agtgctgggatcacaggtgtgagctaccacacccatctaaaatgtattattaaaattaat
ttcatttgtttcacttttctgtttttaatgtgtcactaataaatttggagagcgcattgt
ttctgtgattcttgaaaatcaggcttgcattctttcgttacatttgttttactattatag
GTATTAGAACTGATATGTACTCGTGAGTCAGGAGCAGTCTTTGAGGCTGGTGGTTTGAAT
TGTGTGCTTACCTTCATTCGTGACAGTGGACATCTAGTTCATAAAGACACCTTGCACTCT
GCTATGGCTGTGGTATCAAGACTCTGTGGCAAAATGGAGCCTCAAGATTCTTCTTTAGAA
ATTTGTGTAGAATCTCTGTCTAGTTTATTAAAGCATGAAGATCATCAG
gtaaataagttgctgttacatactttccattttcagaaagtgatttttttagtgttcccc
tgtttataattatgatagactgtaatttgtgcttttcacttgatgaaatcgaggtaattc
catcctctttctctaattttatctctgcatgtggtaatctccattttgggaatgaaactt
EXON 5  282 bp
agtttaagtaacttcctcggattacacagttagcagtatatggagccacgattcaatagg
cagatcacatgcttaatcactttgctgcagttgcctttcttatagtgtcagtattgaaat
gatcattactaaccctttttaggtggattttatctgtgggcattttcttcacattgttag
GTTTCAGATGGAGCTCTGCGATGCTTTGCATCACTGGCTGACCGATTTACCCGTCGTGGT
GTTGACCCAGCTCCATTAGCCAAGCATGGATTAACTGAGGAGCTGTTATCTCGAATGGCT
GCTGCTGGTGGTACTGTTTCAGGACCATCATCAGCATGCAAACCAGGTCGCAGCACCACA
GGAGCTCCATCCACCACTGCAGATTCCAAATTGAGTAATCAGGTGTCAACAATTGTAAGT
CTGCTCTCAACACTTTGCAGAGGCTCTCCGGTAGTAACACAT
gtaagaatgtttttgaatctttgctttttaatcttcagaaaaagtgtttttgtataatgc
taatatattaaacatctttcttcccattctctttctaggatcttctgaggtcggagcttc
cagattcaattgaaagtgcattgcagggtgatgaaagatgtgtgcttgatactatgcgtt
EXON 6  271 bp
agattccaaattgagtaatcaggtgtcaacaattgtaagtctgctctcaacactttgcag
aggctctccggtagtaacacatgtaagaatgtttttgaatctttgctttttaatcttcag
aaaaagtgtttttgtataatgctaatatattaaacatctttcttcccattctctttctag
GATCTTCTGAGGTCGGAGCTTCCAGATTCAATTGAAAGTGCATTGCAGGGTGATGAAAGA
TGTGTGCTTGATACTATGCGTTTGGTTGACCTTCTCTTGGTGCTATTATTTGAAGGACGA
AAAGCTTTGCCAAAGTCTAGTGCTGGATCTACAGGCAGAATCCCAGGACTCCGGAGATTA
GATAGTTCTGGGGAGCGCTCACATCGGCAGCTTATAGATTGTATTCGAAGTAAAGATACC
GATGCACTTATAGATGCAATTGACACAGGAG
gtcagaaaatatttttttaaatataaaaagaaagttgtgagataaccatataggcagttt
ctagttttcggacagtactcttagaaatccagataacaaagtggcaccccttcgatattc
tcccctatccctgtgcataattatgtaattatcagcttggttcttggtgaaacctgaata
EXON 7  77 bp
tgatctcaagtttgctgattatgtactgctctatagttgacctaaatatttaaaacactc
tcttggctctttatttagatgatgactaatgacgatcttaaaatggttcagtctttagaa
aagtttagtattttattggctttaaaaatacgtttctttttttttccttcaaaatttcag
CCTTTGAAGTAAATTTTATGGATGATGTAGGTCAGACTCTATTAAACTGGGCCTCTGCTT
TTGGAACTCAGGAAATG
gtaagctaataaataaaagctggtatttaaattaaggatagaaatattaataaaaagcag
ctttatgattcgttatcattttacaggtagaatttctttgtgagagaggtgcagatgtta
atagaggtcaaaggtcatcatcattacattatgctgcatgttttggaagacctcaagtag
EXON 8  99 bp
ttccttcaaaatttcagcctttgaagtaaattttatggatgatgtaggtcagactctatt
aaactgggcctctgcttttggaactcaggaaatggtaagctaataaataaaagctggtat
ttaaattaaggatagaaatattaataaaaagcagctttatgattcgttatcattttacag
GTAGAATTTCTTTGTGAGAGAGGTGCAGATGTTAATAGAGGTCAAAGGTCATCATCATTA
CATTATGCTGCATGTTTTGGAAGACCTCAAGTAGCAAAG
gtaaagtctaggttttaaaattactaatttttaacatttacatggtttaaaaattagaat
gatataaaaccttttatttccatgccatctccatccacttcattcccccttactcactgt
aagtgtttttaattagttttttctttttagtgtttcctaatacagattcaataaaaacaa
EXON 9  115 bp
tcggcctcccaaagtgctgagattacagaataggctgcttttaaggtactaagtgcaaag
gcagagatatggattgccacctgcttgattaagtaattctggaaaatctttagtttacat
agttggatgtcaaagaaataaagtattgttatattcaaattaaatgcttttcttctctag
ACTCTGTTACGGCATGGTGCAAATCCAGATCTGAGAGATGAAGATGGGAAAACTCCATTA
GATAAAGCTCGAGAAAGGGGCCATAGTGAAGTGGTAGCTATTCTTCAGTCTCCAG
gtgagagctacattctttcttttgaagccatctactgttatttttcagctttcacttcca
tagctttctgtagacacattaaccttatataaatgaactattcctatgaagtcaaataat
tatatatgtatatccttatatttaataaacctgtttaacagcttaattttctatgttctt
EXON 10  175 bp
acattgaagttactagtgctctttagtattcttataagcatcattgaaacaatgttctaa
tttcagtgtatttgttaattagagataattattatttgaagttggatatatcttaaggtt
tttttccttgaaagcaaaagtttccaaaaaagtatttctttaaaaaatatttgtctgtag
GTGATTGGATGTGTCCAGTTAATAAAGGAGATGATAAGAAAAAGAAAGATACAAACAAAG
ATGAAGAAGAATGTAATGAGCCCAAAGGAGATCCGGAAATGGCACCCATATACTTGAAAA
GGTTATTGCCAGTGTTTGCACAAACATTTCAGCAAACTATGCTGCCTTCAATAAG
gtagttattcatactatttgatgtgttagtcaaattacaccaattatatggttttattta
tctcccttttccagaagtatttgaggtttattttaatgttaaaaaggtgtggtaagaata
aaatttagatgagaagtgggaaagccctatcttttcttctgacgatctgaacgaagagaa
EXON 11  139 bp
attatttcaaaaatgaacatatagtgctgagtcccaattttttgtatttttttattaagt
gtatttttttagcagagtgtataaaatgtaacattggatattttactgttcattaatgca
tgcattttgatttattttaacttcatttggcttcatataattctatttttacttttcaag
GAAAGCAAGTCTTGCTCTAATTCGAAAAATGATTCATTTTTGCTCTGAAGCACTGTTAAA
AGAAGTTTGTGATTCTGATGTTGGTCACAATTTGCCTACAATACTAGTGGAAATCACTGC
AACTGTCCTGGATCAAGAG
gtccgtttctttttcaaaactctttagcattaatttcctttagctagtagtctgaaataa
aatttttgttttaatttcagtaaatcatgttgtgcaaattactgcatttctctactcctg
gcaactaaacttatttttattttttatttttcaggatgatgatgatggccacttgctggc
EXON 12  171 bp
tcactgcaactgtcctggatcaagaggtccgtttctttttcaaaactctttagcattaat
ttcctttagctagtagtctgaaataaaatttttgttttaatttcagtaaatcatgttgtg
caaattactgcatttctctactcctggcaactaaacttatttttattttttatttttcag
GATGATGATGATGGCCACTTGCTGGCTTTGCAGATCATAAGGGATTTAGTAGATAAAGGT
GGTGATATATTTTTGGATCAGCTAGCCAGACTTGGTGTAATTAGCAAAGTGTCAACGTTG
GCAGGTCCTTCCTCTGATGATGAGAATGAAGAGGAATCAAAACCAGAAAAA
gtgagtggtcttaattatagaggtatcaggaagagttttttttttttttttgaggaaaat
ctagtttcaatttttgatggtttttgacaggataatgacaatatgaaataattctgtata
ttttttaaattggtcaattttcttttaaaacattttgatcaacaattttaaacatataga
EXON 13  223 bp
atgacagagttgagaccatgtttctaaaaggggggaaaaagattaagctacaggcaattg
agtattatgttcagagtatttaaatttgaaattaaattagattcatgtttttaaaatatg
tatgaatatttgaaattgaaattattttccatgtttaattgaataattctacacatttag
GAAGATGAACCACAGGAAGATGCTAAAGAATTGCAACAAGGTAAACCATATCATTGGAGA
GACTGGTCAATCATTAGGGGAAGGGACTGCTTATATATTTGGAGTGATGCAGCAGCCTTG
GAATTATCTAATGGCAGTAATGGATGGTTCAGATTTATCTTGGATGGAAAACTTGCCACC
ATGTATTCAAGTGGTAGTCCGGAAGGTGGATCTGACAGTTCAG
gtaatattttgtttcaattaaaatattttcctagtttctacagtttggtttttttctcat
atttttgctaccattgtcaaggtattttatttttttgagacggagtctcactctgtcacc
caggctggagtgcagtggtgcgatctcggctcactgcaacctccacctctcaggttcaag
EXON 14  264 bp
ttagcttcccaagtagctgggactacagatgcgtaccaccatgcctggctaatatttcca
gtttctaatttagttttattgtttaaaatttatattttaataggtctttttttcctaaga
gaaaatacatgtcatacttgaaagaaataagattttgaaacaagtattttgtctttatag
AAAGCCGAAGTGAATTCTTAGAGAAGTTACAAAGAGCTCGAGGCCAAGTAAAGCCATCTA
CTTCAAGTCAACCTATACTGTCAGCACCAGGACCCACTAAACTTACTGTAGGAAATTGGT
CACTGACATGTTTGAAAGAAGGAGAAATTGCTATTCATAATTCAGATGGTCAGCAAGCTA
CAATATTGAAAGAAGATTTACCTGGTTTTGTATTTGAATCTAATAGAGGAACCAAACATT
CATTTACTGCAGAAACTTCCCTGG
gtaagtatgtagatatgtaagtttattgggtacaaataaatgaatatgttaaattgtaac
aaagtaagctctgtgaatattcttttttttccccccaaggttcagaatttgtgactggct
ggactggcaaaagaggcagaaaactgaaatctaagttagaaaaaacaaagcaaaaggtat
EXON 15  77 bp
tattgaaagaagatttacctggttttgtatttgaatctaatagaggaaccaaacattcat
ttactgcagaaacttccctgggtaagtatgtagatatgtaagtttattgggtacaaataa
atgaatatgttaaattgtaacaaagtaagctctgtgaatattcttttttttccccccaag
GTTCAGAATTTGTGACTGGCTGGACTGGCAAAAGAGGCAGAAAACTGAAATCTAAGTTAG
AAAAAACAAAGCAAAAG
gtatatctgttggatgtgctttattcttgtcttttatactgatttgttaaattttcagtg
gtaaagtataagcactgaaaaaaattgagccatagaacataagcagccctaatataatat
atttttagtttttctattttctgtgttttcttaaatatttatttacatataatttttata
EXON 16  135 bp
cagaacatacataggttgtttcctcaaataactgtaacttcgagagctcatttgtgccca
aatgacagtacatacgtaccttttcgtggtgaaatatgtaaatacgagtgtctataaaag
tgaagatttggtaaaattattaattgtaaaaattcacatttgttgtgtttattttggtag
GTACGAACTATGGCTCGAGATTTATACGATGACCATTTTAAAGCTGTTGAAAGCATGCCT
CGTGGAGTAGTGGTAACACTCAGAAACATAGCAACTCAGTTAGAGTCATCTTGGGAACTT
CATACAAATAGACAA
gtatgtcatcctctagattttaatgatatgtagtgaattttagtttgatgtcttcccctc
tatcctttatgtcatgggtattgagtagggggtcagcaaattatggcccaggagccaaat
ctggcctgctccccattttcgtatggctttatgaggtaagaatggtttttatacttttaa
EXON 17  147 bp
actgggccctttacgaaaacgtttgctgacctctggtagacataatttgtgttaataatt
tgaacttttaattttgcttaatatctaaattattgtcatgataattgatgttctgataag
ttattttaagagctatgtttatgtttttgattgccttcattaaatttttttttcttttag
TGTATTGAGAGTGAGAACACTTGGAGAGATTTAATGAAGACAGCTTTAGAAAACCTAATT
GTACTTTTGAAGGATGAAAACACAATTTCACCATATGAAATGTGTAGCAGTGGCTTGGTA
CAAGCACTTCTTACTGTGTTAAACAAT
gtaagtttatcaagtagtaaagaacaaaaatacagttttaaaaattatttgtagttactc
cttcggtagagtggtttttagtttgttttgtcaagaaatatttaaaagctgaatgatgtt
aatatttctaatttcttcagcctttaggttttatgattagtttgagccaaatgaattaaa
EXON 18  106 bp
attcttaagtaaaggaaattgagttgtgagagtatttctactcagacataatctaataca
aaaattaaactgtagtcatgaaaaagtaggggtatatattgaagttgattaccatatttt
ctgcatgaacatttacatgtagttatacaaaacctcttaataataattatttcttcgcag
TCGACCAGCAGTTGCGTTAATTCGAAAGTTAATAGCTGTACTAGAATCTATTGAACGTCT
ACCTCTCCATTTGTATGATACACCAGGATCCACATATAACCTCCAG
gtaaccataaaaaatgtagtagctagtattgctgaatgcatctaggaacagtgtgacact
tttctttaaaaaaaattattttctttcacatcggattaaaataaaaatgattctacttaa
tctttaaagattttagcttatatgccatttgattgatcttaatgacttgaagtctgtttt
EXON 19  135 bp
cgtctcagaaaaaaagaaaaaaaaaaagaatctttgatagaaaacagacatttgttcata
gttctattatgtttatagttaataaatccaaatctcagttgttttagggtatatcatttt
ttacaattctgagacagaaaccaagacgttttccagagtattttgatcgtttttgtgtag
ATACTTACAAGGAGATTACGATTTCGGTTGGAACGTGCACCTGGTGAAACTGCATTGATT
GACAGGACTGGCAGAATGTTGAAGATGGAACCTTTGGCTACAGTTGAATCTCTGGAACAG
TACCTTTTGAAAATG
gtgagtttctggcaagggcacggtgaaataagcattctgagctgtggtttagccttttag
gacaataatttgggaagtatatatccagagttatggtaatacagtttggcccagtaattc
cattttagaactgatttctacatgaagatgtttattataattttgtaatattgaaatagt
EXON 20  140 bp
cacccacctccgcctcccaaagtgctgggattacaggcgtgaaccaccgcacccggccta
aatgagcatttgttataataaaagaaaacaattcacattaaagagataggaaaaaagtag
gtaacgtgcttgaaaacagcattattaaggtgactgtctttcatattttctttggtttag
GTAGCAAAACAGTGGTATGATTTTGACCGATCTTCATTTGTTTTTGTTCGAAAATTAAGA
GAAGGACAAAATTTTATATTTCGGCACCAGCATGATTTTGATGAAAATGGAATCATTTAC
TGGATTGGAACAAATGCAAA
gtaagtcagtcattttactttaagctggagtgaccatattcacttggtaaaagaattcta
ggaagtagaataaaattgttagcactctgaatattctgtggtttaaggaattttgacttg
taggtagaagttaagattatccaaattactttttatgaggaaaaaatgtctaaattgcta
EXON 21  324 bp
gtttaaggaattttgacttgtaggtagaagttaagattatccaaattactttttatgagg
aaaaaatgtctaaattgctaattctagaattgtacttaatataattctgtatttaaaacc
ttgtgcaaatgcaattatcttaacgttgttatttgctaatttttctttatttttgtatag
AACTGCTTATGAATGGGTAAATCCAGCTGCCTATGGACTTGTAGTAGTAACGTCATCAGA
AGGAAGAAATCTACCTTATGGCCGCTTAGAAGACATACTAAGTCGTGATAATTCAGCTTT
AAATTGTCATAGCAATGATGATAAGAATGCCTGGTTTGCCATAGATCTGGGTCTCTGGGT
GATACCATCAGCATATACACTTCGTCATGCTCGTGGTTATGGAAGGTCTGCACTGAGAAA
TTGGGTTTTCCAGGTATCCAAAGATGGACAGAACTGGACTTCTTTGTATACCCATGTTGA
TGACTGCAGTCTCAATGAACCAGG
gttagttgaggagtctttgcaaattggaaaactcactaaagagctttgtttatttttata
attttatactctagagctctcttccttgtgaaatattgaagcaaaattttctttctaaaa
acaaatcacttgatactttaggcattaaaactttgaaacactgactttactaaaactttg
EXON 22  167 bp
ttgttctcttgactactttttttcctttgatttcttgattcttgtaatgaactgttgagt
taatatgaaagttagtttattttttctacaggtctctgttatataaaaaatctttcccat
cttgaatttctttttcatcttttaaaatattacataattttttctctaacatattaacag
GTCAACTGCAACTTGGCCTCTTGATCCACCAAAGGATGAGAAACAAGGGTGGAGACATGT
GAGAATTAAACAGATGGGGAAAAATGCCAGTGGACAAACACACTACCTCTCATTATCTGG
ATTCGAACTTTATGGCACTGTAAATGGAGTATGTGAAGATCAGCTAG
gtaaagagatgatacgaggcttttctaacttactaaaacaattacttttgtaaaaagtga
tttggtttttatttctccaatttctacctgacagggaaagcagctaaagaagcagaagct
aatcttagacggcagagacgtctagtacgttcccaggttctgaaatacatggttccagga
EXON 23  177 bp
aaatgccagtggacaaacacactacctctcattatctggattcgaactttatggcactgt
aaatggagtatgtgaagatcagctaggtaaagagatgatacgaggcttttctaacttact
aaaacaattacttttgtaaaaagtgatttggtttttatttctccaatttctacctgacag
GGAAAGCAGCTAAAGAAGCAGAAGCTAATCTTAGACGGCAGAGACGTCTAGTACGTTCCC
AGGTTCTGAAATACATGGTTCCAGGAGCTCGTGTTATCAGAGGCCTGGATTGGAAATGGC
GAGATCAGGATGGCAGCCCACAGGGAGAAGGCACTGTCACAGGAGAACTACACAATG
gtgagtaggtgctcagcacttttgtgtagaaaatgggtagttaaattttttcttttaaga
taatttataaattgcataaatgtatgagcactgtttagaagaactgttgataccacatta
caaatggaaaaaaggtaaagaaaataagggaaaattttaagttcttgggttttgactaga
EXON 24  837 bp
atatcgtcaaataattgagtccaaaaatttacatatattttagtgggcagaccttgattg
actatagaaattcagaaaaggacagcactgatgaaaagctgatcccatattgtggagcta
ctgtctgacacgctcctatctgctttctgctgggtctcacaaactcctgtccctttccag
GCTGGATTGATGTCACCTGGGATGCTGGTGGCTCAAACTCTTACCGTATGGGCGCAGAAG
GAAAATTTGACCTCAAGCTTGCACCAGGGTACGACCCTGATACAGTGGCATCACCCAAAC
CTGTTTCATCCACTGTTTCAGGCACAACGCAATCATGGAGCAGCTTGGTGAAAAACAACT
GTCCAGACAAGACATCTGCTGCTGCAGGCTCCTCAAGTAGAAAAGGAAGCAGCAGTTCTG
TGTGTAGCGTGGCCAGTAGCAGCGACATCAGCTTGGGTTCGACCAAAACGGAACGGAGAT
CAGAAATTGTAATGGAACACAGTATAGTTTCAGGAGCTGATGTCCATGAACCAATTGTTG
TTCTTTCATCTGCTGAAAACGTCCCTCAAACAGAAGTAGGGTCATCTTCCAGTGCAAGCA
CCAGCACCTTAACAGCGGAAACGGGAAGTGAAAATGCTGAAAGGAAGTTAGGCCCTGATA
GTTCTGTTCGTACTCCTGGGGAGTCTAGTGCAATATCCATGGGAATTGTCAGTGTTAGTT
CTCCTGATGTTAGTTCAGTATCTGAATTAACTAATAAAGAAGCAGCTTCACAACGACCTC
TTAGCTCTTCAGCAAGTAACAGACTGTCAGTGAGTTCTTTGTTGGCTGCTGGGGCCCCTA
TGAGCTCTAGTGCAAGTGTACCTAACCTGTCCTCAAGAGAAACATCTAGCTTGGAGAGTT
TTGTAAGGAGAGTGGCAAACATAGCACGGACTAATGCCACGAACAACATGAATCTAAGCC
GAAGCAGCAGTGATAACAACACTAATACTTTGGGGAGGAATGTGATGAGCACAGCAA
gtaagtgagcttttccttctggaatccgatgctttttccacttggagggatgcaaaatag
ggtctcttgttctggctgcagtttttaactagatcattaaccatgttagataaagctaca
tcaaatttagcagttcaggaatatgaagttctctagaatcataatatttgcagaattcag
EXON 25  222 bp
tgctataaaaagaatttttagttggatttcagttgggttcccaaagttgttgcttttcag
gaaccattttattattagtgtgttttatgacctcactctttaaaaaataaaaaacttggt
ttttctgaggtttctacaatctcacctatttgtactgatttgcttcatttttgtctttag
CTTCTCCTCTTATGGGTGCTCAGAGTTTCCCTAATTTGACCACACCTGGTACTACATCAA
CAGTGACTATGTCAACATCCAGTGTTACTAGCAGCAGCAATGTAGCTACAGCAACAACAG
TTTTATCAGTTGGTCAATCTTTAAGTAACACTTTAACCACCAGCCTCACATCAACTTCCA
GTGAGAGTGACACAGGTCAGGAAGCAGAATATTCCTTATATG
gtaagttgtaatttaaaatgaaagtatttagatactttcataatgatgcttttattatgt
tttctcctgatattttaaacttttgtttaaagagaattattctctcttcttataaatatg
aaatcttcgggccaggcacagtagctcacacctgtaatcccagcactttgggaggccgag
EXON 26  134 bp
ttgtcctttatcacttgtttttgtcatgcttgtgtctgtgctcatcttgtatgtggtggc
agaacgcaacagttgtcccttttgaattttacttttgttttgtaaaaacctaaaatgcaa
agttcctttgttatgctttcttaattgtgttgacataaggttgtgggttttgttttcaag
ATTTCCTTGATAGCTGCCGTGCCAGTACTCTATTGGCTGAGCTCGATGATGATGAGGACT
TACCTGAGCCAGATGAAGAAGATGATGAGAATGAAGATGACAATCAGGAGGACCAAGAAT
ACGAGGAGGTTATG
gtagagagagtaccccattctctttacaaagataggatgttaataattgaaatgaagaaa
ggaaaagctaagtcataatcaaactttgaagcaaggaaatgtggcaccagtataaaaaat
gtagttaattaagaaaagcagttttaatctgagcatttatgattctccacttaaagaaaa
EXON 27  123 bp
agtataaaatgcatgatgaatttaaaacattgaactcataacttttctgaagttggctaa
tgaaaaagttttcagtgacacttttgttaataggggttaatatattcaggtcatggctga
aagggggcatatatgggtcaaataattagacatgtatctcttgggattgttttattttag
ATTCTGAGACGCCCATCCCTGCAACGTCGAGCTGGCTCCCGCTCTGATGTAACGCATCAT
GCTGTTACCTCGCAGCTACCACAGGTACCTGCTGGAGCAGGGAGCCGACCTATTGGGGAG
CAG
gtaatatcttcatgtttatcttccctaccatatgtatatttttcccttttatagtaaagc
accaacctaaatgcctacaaaaatgtgcagtgtggaaggggtgagaggagggagctacca
aacagttacacaaagaaacttcccctactggttgggtttcatattctatatagaatccat
EXON 28  157 bp
cttactttgggtaaactgaaatgatgaagaaatgtatgtatctatacatgtttaggttag
ctcattttgggtttaagaaatatggctaaggaaatgcagtagttctaaataacacattgc
ttttgcaacaatgaaattttgcatcttattatgtttgtgtgtgaaattttattttgatag
GAAGAAGAAGAGTACGAAACTAAAGGAGGACGCCGGAGAACATGGGATGATGATTATGTG
CTAAAGAGACAGTTTTCTGCATTGGTTCCTGCTTTTGATCCTAGACCTGGTCGTACTAAT
GTCCAGCAGACAACTGATCTAGAAATACCACCCCCAG
gtacagaatgttttggttttgtgatttaattttaatacatactaaatcagatatgaaaag
tagggtgttgcttttgtatgcacgttattaaaaatttttttttagttttgtgtatgcagg
ttataaaaaatttttttagtcagccacaaattctttaaaaagtaaaggtttttttaaagg
EXON 29  223 bp
aaaaaaagaaacagaaagcaaaaatgtcgacgcctagagagtcttaagtagctgacatcc
tttagctaatatatggcagagaggtttggatttcatgtagccttgtttcctagtgtagtg
gcctttcttggactgcttgttttagtataattgtttttcacccatcttccaaatttttag
GGACCCCTCATTCAGAGCTCTTGGAAGAAGTCGAATGTACTCCGTCACCTCGATTAGCTC
TCACTTTGAAAGTAACAGGTCTTGGAACGACTCGTGAAGTTGAATTACCACTCACCAATT
TCAGATCAACCATCTTTTACTATGTACAAAAATTGCTTCAATTGTCCTGTAATGGCAATG
TGAAATCAGATAAACTTAGGCGTATTTGGGAGCCCACATACAC
gtaagaaattttaacttaatgttttggtagataatgtcctagtgtagagccaagaagcat
tgcatttattttggattataggaacagaaaagattttgtttttattctgttggcttacag
gaacagataatagtgtttgggactcttggtgtagaatgattaagttttagaagtagaagg
EXON 30  55 bp
caacatagcaaaaccttatctctacaaaaaatatagaaaaaaagaatcctccttgagttc
agtgttcagtgcaggcatatgtctagtgaatgacattcacttttttttttaaagaattga
agccttattggaaataatcacaaattatatatgaattaacttgaatatcttcatgtttag
AATCATGTACAGAGAAATGAAGGATTCTGATAAAGAAAAGGAAAATGGAAAAATG
gtaagttattttagaacattggtttactcttggctatttagttaaaagaagaaagatagt
aaaactaacacagtattgcagttgaacgttgaagggaataatgactaacatggaattctt
tagattagaccaagtgcatgatcttaaagctacctcatgtaatgcatgtgaaatatcata
EXON 31  183 bp
agaagaaagatagtaaaactaacacagtattgcagttgaacgttgaagggaataatgact
aacatggaattctttagattagaccaagtgcatgatcttaaagctacctcatgtaatgca
tgtgaaatatcatagactttataattgggaaaggccaacatttggtttttcctgttgtag
GGTTGCTGGTCTATAGAGCATGTGGAGCAGTACCTTGGCACTGATGAATTACCAAAGAAT
GACTTGATAACCTACCTGCAGAAGAATGCAGACGCTGCTTTCCTGCGCCACTGGAAATTA
ACTGGCACTAATAAAAGTATTAGGAAAAACAGAAATTGTTCTCAGCTCATAGCTGCATAT
AAG
gtatatattggcatcaaaacactattttgattgcaaatggcttcgtgctttgttttgcag
ctttggaagcttcttaaggaacagcagttcattgagacataattttaaaaatgaggttga
attaacactgttaatgcacaaattctaaaatttcaaatatggctggtagcattggatctg
EXON 32  208 bp
atattttatttgggaattttaatggtttagaatgccttgatttatgtcttgtgttatgtt
tttatttaaaaagaaggcactttaaaaaattccaaccctttcatagtggtattgatacaa
tgatacactgtttttcttgaaaatgtgattaatggccagtttttctaattgtttctatag
GATTTTTGTGAGCATGGAACAAAGTCTGGGTTAAACCAGGGGGCCATTTCTACTCTTCAA
AGTAGTGATATTCTTAATTTAACAAAAGAACAACCTCAGGCCAAAGCAGGCAATGGACAG
AACTCTTGTGGAGTAGAAGATGTCCTTCAGCTTCTGCGTATTCTATATATAGTTGCAAGT
GACCCTTATTCAAGAATATCCCAGGAAG
gtctgtaagaagccttgtttcatttctatagcagttttaaagcaagtcagtttatatttt
tattaattttattaattaattttatagatggtgatgaacagcttcagtttacttttccac
cagatgaattcactagcaaaaaaattacaacaaaaatattacagcagattgaggtaataa
EXON 33  86 bp
gacagaactcttgtggagtagaagatgtccttcagcttctgcgtattctatatatagttg
caagtgacccttattcaagaatatcccaggaaggtctgtaagaagccttgtttcatttct
atagcagttttaaagcaagtcagtttatatttttattaattttattaattaattttatag
ATGGTGATGAACAGCTTCAGTTTACTTTTCCACCAGATGAATTCACTAGCAAAAAAATTA
CAACAAAAATATTACAGCAGATTGAG
gtaataaaatcagacagctgaactcttcattctattactgttggacttttcctaatattc
cctttactttcttttctacctctcaccatctttcccttccctctgattggtaatttgagc
tatatggtcctttgcatttatttcctaattacaggtttataattgacttggtaattttta
EXON 34  128 bp
gcaggagaatcgcttgaacccaggaggcagaggctgcagtgagccgagatcgtaccactg
cacaccagcctgggcaacagagtgagactctgtctcaaaaaaaaaaatgaacgaatgaat
gaatgcatgcatgcatgaatgccttatagcactaagacattattatttgttaattcgcag
GAACCATTGGCACTGGCAAGTGGGGCTCTGCCAGACTGGTGTGAACAATTAACCAGCAAA
TGTCCTTTTCTAATACCATTTGAAACTAGACAGCTTTATTTCACATGTACAGCATTTGGC
GCCTCAAG
gtaagaagccttttttttatgtttttagaataagtatgcttttatgttatgtaagttgaa
aatgtacaactatactgtcaagactgatagagggaatatattatcttgtattcttataaa
gaatagtcagcattgccttttggcctgaactaccaatcttctagtaattcgccaaaatga
EXON 35  202 bp
catatatttttacttgtgacaggaagcagtttatgtaacaaaaaaagattactgtgtttt
aaaaatcacctgataaaatactattttttaatttcttaaatctttgaattctgttgctgg
tttagtagtacattcagctgttaacgtatgctgcagctcatagatatttttctatttcag
AGCAATAGTATGGTTACAGAACCGACGTGAAGCCACTGTGGAGCGAACGAGAACCACAAG
CAGTGTTAGGCGAGATGACCCTGGAGAGTTTCGAGTTGGTCGTCTCAAGCATGAAAGAGT
AAAAGTTCCACGTGGCGAGTCACTGATGGAATGGGCTGAGAATGTCATGCAAATACATGC
AGATCGGAAATCAGTTCTTGAG
gtaatctcatataaaattagatttagggaacaggaatgacacttagggaaccagcccaat
gtgtatcttcactgcattaaaaactgtggtaggtaaacatgaagaggggttttcctgttc
tgtaggcagaagccttctcctctggcagagcatctttttcataagaggatgtcagtccac
EXON 36  138 bp
gtggactctttaggaaaattaaaataacacttctgtgctgtttattatatatatacactg
ctattttgaaaaaaggtacattactggatcagatatgataaattttgacaagaattagat
tatttttaaaaacaccccaaactttacgtttaacccacaatttatttgttcatattttag
GTTGAATTTTTAGGAGAAGAAGGAACTGGCTTGGGACCCACATTAGAGTTTTATGCTCTG
GTGGCAGCAGAATTCCAGAGAACTGACTTGGGAGCTTGGCTTTGTGATGATAATTTTCCA
GATGATGAATCTCGTCAC
gtaagaatatttctcattttgtgacttgagttgtgactctgctttcaaaagtgttaaaaa
taggttatgtgttcagagcataagccaggtttctgactctacttttattattgaataatc
ttgatgcaattaaaatagttctaaagcgataaaatttagtcaccaaaagctatttaataa
EXON 37  608 bp
aatagttctaaagcgataaaatttagtcaccaaaagctatttaataaaattatatacttt
tagatagccaaattcatgaagatgtttaatgtttatggatttttttcttagatgatgata
ggcttagtttctattaacttttgtttaattttatttgcatttcaccctctaaaaaattag
GTTGATCTTGGAGGTGGATTGAAACCTCCTGGATATTATGTGCAGAGGTCATGTGGACTG
TTCACAGCACCATTTCCACAGGATAGTGATGAGCTTGAAAGGATCACGAAACTGTTTCAT
TTCCTTGGAATTTTCTTGGCCAAATGCATTCAAGACAATAGACTTGTGGACTTACCTATT
TCTAAACCTTTTTTTAAACTTATGTGTATGGGTGACATTAAAAGCAATATGAGTAAACTG
ATTTATGAGTCACGAGGTGATAGAGACTTACACTGTACTGAAAGTCAGTCTGAAGCTTCT
ACAGAAGAAGGTCATGATTCACTCTCGGTAGGAAGCTTTGAAGAGGATTCAAAATCAGAA
TTTATTCTTGATCCCCCTAAACCAAAACCCCCAGCTTGGTTTAATGGAATTTTGACTTGG
GAAGACTTTGAATTAGTAAACCCACACAGAGCCAGATTTTTAAAAGAAATTAAAGACCTT
GCTATCAAGAGGCGCCAAATTTTAAGCAACAAAGGTCTTTCTGAAGATGAGAAGAACACA
AAATTACAGGAACTAGTGCTGAAGAATCCATCAGGTTCTGGGCCTCCACTTAGCATAGAG
GATTTAGG
gtaagcattatatgtacattcttcaatccaatgcatgaataagttttaaagcttttgttt
ctttgtcgtcactgatttgcaatatatgagtaaatagtctgtcaaaaacagtaatatgct
gtaggaaatattgatgatcgacttgaacctttgatttaatattataaagacaacactcag
EXON 38  79 bp
ctggtgtactgattttgttggaggaggagaggggtgggatttatggttttgatagccatg
ttattttatttaattttttctcttgtacccactgatggcagatgatagtaatgttataaa
aattaaacaccattagtagtagctgcatgtcagttaatttaatcttttttgtcctcccag
TTTAAATTTCCAGTTTTGCCCTTCCTCAAGAATATATGGTTTTACAGCTGTGGATCTCAA
GCCAAGTGGTGAAGATGAG
gtaaaaagtttgcttttaatatagttgtaagttctgacatatcctcttagcaaggccagt
tgtactagacactcctgaaatattcctagatactgacaaattttcttttgcagatgataa
caatggataatgcagaagaatatgtggatttgatgtttgacttttgtatgcatacgggta
EXON 39  94 bp
gttttgcccttcctcaagaatatatggttttacagctgtggatctcaagccaagtggtga
agatgaggtaaaaagtttgcttttaatatagttgtaagttctgacatatcctcttagcaa
ggccagttgtactagacactcctgaaatattcctagatactgacaaattttcttttgcag
ATGATAACAATGGATAATGCAGAAGAATATGTGGATTTGATGTTTGACTTTTGTATGCAT
ACGGGTATTCAGAAACAAATGGAAGCCTTTAGAG
gtaattttaaaggatttttagcataattgctctcctttcactttgagacagttgaaatta
tggtcaagaattgctggtggtcggctgggcacggtggctcacacctgtaatcccagcact
ttgggaggctgaggcgggaggatcacctgaggttgggagttcgagaccagcctgaccaac
EXON 40  151 bp
gttgcatagtattccattgtgtacatataccacattttctttacacattcatcccttgat
agatacttagattgattctgataatgggtattttggtttgaaatttggtattttggaatc
gtaacttggaaactgagttgtatgtttgttttttgtgtttccgttacatgtacgatgtag
ATGGGTTTAATAAAGTTTTTCCAATGGAGAAATTAAGTTCCTTCAGCCATGAAGAAGTCC
AAATGATTCTTTGTGGAAACCAGTCACCATCCTGGGCAGCAGAGGATATTATCAATTACA
CTGAACCTAAGCTGGGTTATACACGTGACAG
gtatgtgatactattttccaagatcaacaaaattatttatattccccaaatcaaatgaca
gattctctaaagaactttaattcagtgagtatcataaagtaagtgagaaagcagtggtgt
ctcacagttaccagaatgcatatccactgataaggctgggaggatacaaaaagacaactg
EXON 41  145 bp
atttttaaagtagcttatattagcccatttcatacttaaccaagagtctctagatgtgtt
gttgttctggtgtgaggatattgttttttagggggcttgttgctgccttagaaaatagtg
gtagtgattttcatttaaatctgcagtcaactcaatataactatatttttgttcttttag
CCCTGGTTTCCTGAGGTTTGTGAGGGTTTTATGTGGCATGTCTTCTGATGAAAGGAAAGC
ATTCTTGCAGTTTACCACTGGTTGTTCAACTCTACCCCCAGGTGGACTGGCTAACCTGCA
TCCCAGGCTCACGGTTGTACGCAAG
gtacaagctctctggctaatggggaatccaaatgaaatttagttactttacttttgaaag
aaagaagtatttaaactcatggtcttctgttgtgtttgctttcttgttgtaggttgatgc
tactgatgcaagctatccatcagtcaatacatgtgtgcattaccttaagttgcctgaata
EXON 42  950 bp
ctggttgttcaactctacccccaggtggactggctaacctgcatcccaggctcacggttg
tacgcaaggtacaagctctctggctaatggggaatccaaatgaaatttagttactttact
tttgaaagaaagaagtatttaaactcatggtcttctgttgtgtttgctttcttgttgtag
GTTGATGCTACTGATGCAAGCTATCCATCAGTCAATACATGTGTGCATTACCTTAAGTTG
CCTGAATATTCTTCCGAGGAGATCATGAGAGAGCGCCTGCTAGCTGCTACAATGGAGAAA
GGCTTTCATCTCAATTGAGCTTTGAAGTGCAATGGGAGACATCAGAGACTTTAAAAATAC
TAGTGAAGCCTCTTGTGTTTGTGTGCAGAGAAGTATATGATCCACCATGCTAATGACACT
TGCCTTTTTTTCCACCATTAAGGCTTTAAGAACATGTGGAATAAGTTTTTTAGCTGCTAA
TGACAAAACAAATCCTGTAACTACCCAGCCAGCAAGTATATAGCACAGAACACTGTGTTA
CTTTACAAGGGCTTATGTGACTGGAATAAGGTGGTCCCACTTGACTGTTCCAAAGAGCAG
CTTCTCAGATCTTCAGTGTTCACTGGTAAATTTCTAACAGTGTATTTGTGTAAAGTTTGT
CATTTCATACTCCATACACTACAGTTGCTGTCACTGATCCCTGTTTTGCTGGCTTTTAAG
CTACTTGGTCAAAAATCCTGCTTCCTTAAAACATAGAGAATTAATGAGCATCTCAAGCTT
TTTCTTTTCCTTTTTAATGATGCCTGCACTATCAAGAGTATTCTAGTGTTCTCTCTTTGT
TTGGCATATAATCATGCACCAAACTTTTTATTTCTTTAAGGTGGGAGTATATTTTTATTT
CCTAAATGCCATACTATGAAGATCAAAGTCTTAAGTGTGTTTGCAGCTCAAAAATAAAGA
TGTATTAAGGGGGGAAAACCTGGTCTAAGTGCAAGGCACACTTACAGCGAGTTTTACTTT
CGGTTGTATTTTCTTTGTATATTATAAACATTTATTTAACTTGTTGCCGTTTGAAGTAAA
AAATTTCCAAAATGTATGCTCAACAATAATCATTAAAATGTTTGCAGCGT
acagaactgtgtcatgtgactatttcaatgcagtcatcagacttaagagctttagcaggt
acttgtcattttgaatcatccaaagttttctgaaattactacataaagaaatgtgttttt
ctatagtaaatacgggtattaaaattgaaaggctagaagaaatatatattcacacacttg