Gene GPX2 Variant 1
DNA : 3.66 KbNT_026437
mRNA : 994 bp NM_002083
CDS : 573 bp NP_002074
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  309 bp
atagatatcaaattggcccttcccaggttgcagcagggtggggcggggaggcggccttgt
tcagtctgttaataggaggagcaacctccttgttcaaacagcacttacaggtggggacct
gtttttgctaagtcatcctggggatgctcaaagctccattgttagatcctttctgtcctc
CTTCCTGGCTCCTCCTTCCTCCCCACCCCTCTAATAGGCTCATAAGTGGGCTCAGGCCTC
TCTGCGGGGCTCACTCTGCGCTTCACCATGGCTTTCATTGCCAAGTCCTTCTATGACCTC
AGTGCCATCAGCCTGGATGGGGAGAAGGTAGATTTCAATACGTTCCGGGGCAGGGCCGTG
CTGATTGAGAATGTGGCTTCGCTCTGAGGCACAACCACCCGGGACTTCACCCAGCTCAAC
GAGCTGCAATGCCGCTTTCCCAGGCGCCTGGTGGTCCTTGGCTTCCCTTGCAACCAATTT
GGACATCAG
gtgaggggtccctccttgtaatgcaccaaaagtgttgggttggtgtagctcaggtgggat
aaaaggagaggctgaatgaccatgttttggagtgtctggaataatggggtatgttttgtt
aagctaggtctttaggtgcatgtgacataccaagagaaggtatatattttttaagattaa
EXON 2  685 bp
cttgagcccagaagttcaaggctgcagtgagcaacacctcgtctgtcttgtctctctctc
tttcacagtgaaaaagaatgaccctggggagggagtgtaggagggtgaaagagtttcatg
ttgtggatctttctcttcccccacccactgtccacgcactttgtctttttcctcccctag
GAGAACTGTCAGAATGAGGAGATCCTGAACAGTCTCAAGTATGTCCGTCCTGGGGGTGGA
TACCAGCCCACCTTCACCCTTGTCCAAAAATGTGAGGTGAATGGGCAGAACGAGCATCCT
GTCTTCGCCTACCTGAAGGACAAGCTCCCCTACCCTTATGATGACCCATTTTCCCTCATG
ACCGATCCCAAGCTCATCATTTGGAGCCCTGTGCGCCGCTCAGATGTGGCCTGGAACTTT
GAGAAGTTCCTCATAGGGCCGGAGGGAGAGCCCTTCCGACGCTACAGCCGCACCTTCCCA
ACCATCAACATTGAGCCTGACATCAAGCGCCTCCTTAAAGTTGCCATATAGATGTGAACT
GCTCAACACACAGATCTCCTACTCCATCCAGTCCTGAGGAGCCTTAGGATGCAGCATGCC
TTCAGGAGACACTGCTGGACCTCAGCATTCCCTTGATATCAGTCCCCTTCACTGCAGAGC
CTTGCCTTTCCCCTCTGCCTGTTTCCTTTTCCTCTCCCAACCCTCTGGTTGGTGATTCAA
CTTGGGCTCCAAGACTTGGGTAAGCTCTGGGCCTTCACAGAATGATGGCACCTTCCTAAA
CCCTCATGGGTGGTGTCTGAGAGGCGTGAAGGGCCTGGAGCCACTCTGCTAGAAGAGACC
AATAAAGGGCAGGTGTGGAAACGGC
cagcctgtgtgtgtgttctttgacagagggcggagggaagctacaaactgcaggtgggat
agaggagctgctagcacacaaagctttgggaggggaggatctgacggatcaagggatgcc
ctaattactgacaggaaagcaagcgctggccaaggtctgcagtggcaggtgcagttacgg