Gene FOS Variant 1
DNA : 3.38 KbNT_026437
mRNA : 2084 bp NM_005252
CDS : 1143 bp NP_005243
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  296 bp
taggacacgcgccaaggcgggggcagggagctgcgagcgctggggacgcagccgggcggc
cgcagaagcgcccaggcccgcgcgccacccctctggcgccaccgtggttgagcccgtgac
gtttacactcattcataaaacgcttgttataaaagcagtggctgcggcgcctcgtactcc
AACCGCATCTGCAGCGAGCATCTGAGAAGCCAAGACTGAGCCGGCGGCCGCGGCGCAGCG
AACGAGCAGTGACCGTGCTCCTACCCAGCTCTGCTCCACAGCGCCCACCTGTCTCCGCCC
CTCGGCCCCTCGCCCGGCTTTGCCTAACCGCCACGATGATGTTCTCGGGCTTCAACGCAG
ACTACGAGGCGTCATCCTCCCGCTGCAGCAGCGCGTCCCCGGCCGGGGATAGCCTCTCTT
ACTACCACTCACCCGCAGACTCCTTCTCCAGCATGGGCTCGCCTGTCAACGCGCAG
gtaaggctggcttcccgtcgccgcggggccgggggcttggggtcgcggaggaggagacac
cgggcgggacgctccagtagatgagtagggggctcccttgtgcctggagggaggctgccg
tggccggagcggtgccggctcgggggctcgggacttgctctgagcgcacgcacgcttgcc
EXON 2  252 bp
gctgcggaatgcctgggaggaaaagggggagacctttcatccaggatgagggacatttaa
gatgaaatgtccgtggcaggatcgtttctcttcactgctgcatgcggcactgggaactcg
ccccacctgtgtccggaacctgctcgctcacgtcggctttccccttctgttttgttctag
GACTTCTGCACGGACCTGGCCGTCTCCAGTGCCAACTTCATTCCCACGGTCACTGCCATC
TCGACCAGTCCGGACCTGCAGTGGCTGGTGCAGCCCGCCCTCGTCTCCTCCGTGGCCCCA
TCGCAGACCAGAGCCCCTCACCCTTTCGGAGTCCCCGCCCCCTCCGCTGGGGCTTACTCC
AGGGCTGGCGTTGTGAAGACCATGACAGGAGGCCGAGCGCAGAGCATTGGCAGGAGGGGC
AAGGTGGAACAG
gtgaggaactctagcgtactcttcctgggaatgtgggggctgggtgggaagcagccccgg
agatgcaggagcccagtacagaggatgaagccactgatggggctggctgcacatccgtaa
ctgggagccctggctccaagcccattccatcccaactcagactctgagtctcaccctaag
EXON 3  108 bp
gctgaggatcttattttaaatgcaagtcacacctagtctgcaactgcaggtcagaaatgg
tttcacagtggggtgccaggaagcagggaagctgcaggagccagttctactggggtgggt
gaatggaggtgatggcagacacttttactgaatgtcggtctttttttgtgattattctag
TTATCTCCAGAAGAAGAAGAGAAAAGGAGAATCCGAAGGGAAAGGAATAAGATGGCTGCA
GCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCG
gtaggtactctgtgggttgctcctttttaaaacttaaggggaaagttggagattgagcat
aagggcccttgagtaagactgtgtcttatgctttcctttatccctctgtatacaggagac
agaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaagga
EXON 4  1428 bp
ggaataagatggctgcagccaaatgccgcaaccggaggagggagctgactgatacactcc
aagcggtaggtactctgtgggttgctcctttttaaaacttaaggggaaagttggagattg
agcataagggcccttgagtaagactgtgtcttatgctttcctttatccctctgtatacag
GAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTG
AAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCT
GATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTG
CCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCT
GAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAG
CCCTTTGATGACTTCCTGTTCCCAGCATCATCCAGGCCCAGTGGCTCTGAGACAGCCCGC
TCCGTGCCAGACATGGACCTATCTGGGTCCTTCTATGCAGCAGACTGGGAGCCTCTGCAC
AGTGGCTCCCTGGGGATGGGGCCCATGGCCACAGAGCTGGAGCCCCTGTGCACTCCGGTG
GTCACCTGTACTCCCAGCTGCACTGCTTACACGTCTTCCTTCGTCTTCACCTACCCCGAG
GCTGACTCCTTCCCCAGCTGTGCAGCTGCCCACCGCAAGGGCAGCAGCAGCAATGAGCCT
TCCTCTGACTCGCTCAGCTCACCCACGCTGCTGGCCCTGTGAGGGGGCAGGGAAGGGGAG
GCAGCCGGCACCCACAAGTGCCACTGCCCGAGCTGGTGCATTACAGAGAGGAGAAACACA
TCTTCCCTAGAGGGTTCCTGTAGACCTAGGGAGGACCTTATCTGTGCGTGAAACACACCA
GGCTGTGGGCCTCAAGGACTTGAAAGCATCCATGTGTGGACTCAAGTCCTTACCTCTTCC
GGAGATGTAGCAAAACGCATGGAGTGTGTATTGTTCCCAGTGACACTTCAGAGAGCTGGT
AGTTAGTAGCATGTTGAGCCAGGCCTGGGTCTGTGTCTCTTTTCTCTTTCTCCTTAGTCT
TCTCATAGCATTAACTAATCTATTGGGTTCATTATTGGAATTAACCTGGTGCTGGATATT
TTCAAATTGTATCTAGTGCAGCTGATTTTAACAATAACTACTGTGTTCCTGGCAATAGTG
TGTTCTGATTAGAAATGACCAATATTATACTAAGAAAAGATACGACTTTATTTTCTGGTA
GATAGAAATAAATAGCTATATCCATGTACTGTAGTTTTTCTTCAACATCAATGTTCATTG
TAATGTTACTGATCATGCATTGTTGAGGTGGTCTGAATGTTCTGACATTAACAGTTTTCC
ATGAAAACGTTTTATTGTGTTTTTAATTTATTTATTAAGATGGATTCTCAGATATTTATA
TTTTTATTTTATTTTTTTCTACCTTGAGGTCTTTTGACATGTGGAAAGTGAATTTGAATG
AAAAATTTAAGCATTGTTTGCTTATTGTTCCAAGACATTGTCAATAAA
agcatttaagttgaatgcgaccaaccttgtgctcttttcattctggaagtcttgtaagtt
tctgaaaggtattattggagaccagtttgtcaagaagggtagctgctggagggggacaca
ccctctgtctgatcccttatcaaagaggacaaggaaactatagagctgattttagaatat