Gene CALM1 Variant 1
DNA : 11.02 KbNT_026437
mRNA : 3700 bp NM_006888
CDS : 450 bp NP_008819
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  201 bp
agcgtagggccgccgcgactggcgcgcagggggcggcgggaggcctggcgaacccggggg
cgggaccaggcgggcaaggcccggctgccgcagcgccgctctgcgcgaggcggctccgcc
gcggcggagggatacggcgcaccatatatatatcgcggggcgcagactcgcgctccggca
GTGGTGCTGGGAGTGTCGTGGACGCCGTGCCGTTACTCGTAGTCAGGCGGCGGCGCAGGC
GGCGGCGGCGGCATAGCGCACAGCGCGCCTTAGCAGCAGCAGCAGCAGCAGCGGCATCGG
AGGTACCCCCGCCGTCGCAGCCCCCGCGCTGGTGCAGCCACCCTCGCTCCCTCTGCTCTT
CCTCCCTTCGCTCGCACCATG
gtaggtcgggagtggcaaatgccggcgtagcagctgcccgagatttcttcccagatttct
agttgttttgtttgttttttgtttgtttttggttcttggaggtttttcttttctgagtgt
tacgcagcagctgcgcttaaaggaggttgcattttggatttgcatctcggcgacctctgc
EXON 2  31 bp
tagcataaggagttttctttattctatttactttcattaaatgaccgtgctacaggtttc
aaaggattttaagattgatttttgaaagatcacaatattaaaagtataactggaaaacct
atgttgaaatcaaccaaacatgtcgtggactgaatgataaccttttctttcttcatatag
GCTGATCAGCTGACCGAAGAACAGATTGCTG
gtaagttgacaactccaaggagtccccagaaggccagaactaggcactgactcagttttg
gtgactcctctgttcctccccgctacagtctgggcagttttctaagaatttatttaaata
agaacagtaagcagaaacactgaggtcagatgttattcttgccagtactttatagatgag
EXON 3  144 bp
ggctgctgtatgaaggccagtccaacaggactattgtggtcattatttcagtagataaag
accagacttctgatacgttgcacaacttgaatggctggctttggcaagcccccggcaagt
gtgtattgtgactgggttggataaagacattgattctaacgggtcaacttttgttttcag
AATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGG
AACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATA
TGATCAATGAAGTGGATGCTGATG
gtaagagctttaaaaccatgaatgagggccattgttgtgtaattcaagttcagacatgtt
acaggattgtctttcaggtccccagagcaaagcaaatgtgcaaagatcctttctgtggtt
gccccagggccattgacaattaaaatagaagatgatgggccttgcgtccatcctgcttag
EXON 4  107 bp
aaattgccctgtgaagtgtttgaacgttttagacctgcagatgattgaacctagtaagat
agtctgcccctttgtcctagtacatgtttaccgttccgtacagtggttctgaaatgatta
ctgcagagcagcgttaatggagtgcttactttacatgagctttttgttttttaattcgag
GTAATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATA
CAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAG
gtaatccagcatctacatagcagatggtacttaagtatggcttcttccgctttcacttct
aaaagctataataatgttatagacagaagacttaaatctaactgcctgagcctctgatct
cactttcaaaaatcctccttatggtaaccgtatcaggggagggtaggcataataaatagg
EXON 5  136 bp
gcaaatcctgttttctgcattagctgtttgcatgtatttagtaggttagaggtgggaact
agagatcagagaattgtttatggcagcagagttagcagtaacttgagagggcatagctaa
gtcaaagacctacttccccacactacatcattagcaataacaattgctgaatgttcacag
GATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAA
AAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGA
CAAGTCAACTATGAAG
gtaaaactaaattctctgagctcagtgtttcatagtcttacctttagatctgtaagcaag
ccaactgcttcactagacagcctttgactttattttatgtacagtaaagatgttgtgttc
attaaagctgttttcaaagataaccaaaagttactattatatttgtcttttcagaattcg
EXON 6  119 bp
atgaaggtaaaactaaattctctgagctcagtgtttcatagtcttacctttagatctgta
agcaagccaactgcttcactagacagcctttgactttattttatgtacagtaaagatgtt
gtgttcattaaagctgttttcaaagataaccaaaagttactattatatttgtcttttcag
AATTCGTACAGATGATGACTGCAAAATGAAGACCTACTTTCAACTCCTTTTTCCCCCCTC
TAGAAGAATCAAATTGAATCTTTTACTTACCTCTTGCAAAAAAAAGAAAAAAGAAAAAA
gttcatttattcattctgtttctatatagcaaaactgaatgtcaaaagtaccttctgtcc
acacacacaaaatctgcatgtattggttggtggtcctgtcccctaaagatcaagctacac
atcagttttacaatataaatacttgtactaccttaatgataaggactccttaaagttcca
EXON 7  2962 bp
aagatcaagctacacatcagttttacaatataaatacttgtactaccttaatgataagga
ctccttaaagttccatttgctaatgattaatacactgtttgggctggccagtttttcatg
catgcagcttgacgattgagcacagtcaggcctttgtattaaaaatgaaaaatgaaaaaa
CAAATTCAAAACCTATTCAAATGGGTTCTAGTTCAATTTGTTTAGTATAAATTGTCATAG
CTGGTTTACTGAAAACAAACACATTTAAAATTGGTTTACCTCAGGATGACGTGCAGAAAA
ATGGGTGAAGGATAAACCGTTGAGACGTGGCCCCACTGGTAGGATGGTCCTCTTGTACTT
CGTGTGCTCCGACCCATGGTGACGATGACACACCCTGGTGGCATGCCCGTGTATGTTGGT
TTAGCGTTGTCTGCATTGTTCTAGAGTGAAACAGGTGTCAGGCTGTCACTGTTCACACAA
ATTTTTAATAAGAAACATTTACCAAGGGAGCATCTTTGGACTCTCTGTTTTTAAAACCTT
CTGAACCATGACTTGGAGCCGGCAGAGTAGGCTGTGGCTGTGGACTTCAGCACAACCATC
AACATTGCTGTTCAAAGAAATTACAGTTTACGTCCATTCCAAGTTGTAAATGCTAGTCTT
TTTTTTTTTTTTTCCAATAAAAAGACCATTAACTTAAAGTGGTGTTAAATGCTTTGTAAA
GCTGAGATCTAAATGGGGACAAGGCAGGTGGAGGGGAGGCCAGTGTACATGTAAATGCCC
ACAGCCCAGCATTGGGTTTCCCTCCCAAGGCCCCAGCACCAACCTCTGAGCCCAAGACCT
TGCCTGAAAACAAGCAGATACCGATTGCTTCATCCTATTTATGGACATGTAGGTCTAGTT
GCATTTTCACTGGGGGGAGGGGGGAAGGTGAATTATGGTAACTTTTAATGATCTATTCAG
GCAGTAGAGCTCTTAAGGAAAAAAAAAAACCCACTTTCTCTCAAGCATGTATTTAGGGGT
TGTTCTCAATTGTGCTGCTGATTACCTGTCTTATGTAACTACTTGAGACCATCTGCAAGA
GACATGATTTAGTGTGTCTGTAATTCAATCTTCGCTGTGTGTGGTAGAAGCAGTAGTCAC
TTTTGTAAGCCAGTCTCTTCATGCCTAAAAGACACTACCAGTCACCTTTGATTCGCGACT
TTTAATTTATGATTATACTTAGCCTCCTCCTCCTTTTTTTTTTTTTCCCAAGTTGACTTG
ACTTTGCTTTTTTCCCCCCAAGTAGAACTAATGCTAGCTTCCAGCTTGAAAGTAAAACTC
CAGTGTGGAGTGAATTTTGTGTCTAATTATAAACCTGTAACCAAAACTCAGACATCTGGT
ACTGGTCTTTGCATTGAGATTGGTCCCTGTAAAACCCCCTTTAAAAGCATATTGCATTTA
GTACAGAGCTCTTTTTTGAAATGAAGGCTGGAGATGTGCATTTTTCACGGTGTTAACTGG
TTGTATCTTATTAGCAAGGAGATTGGGGTTTTGAGTGTTTGCGTGGGTGGTTTCAATTTG
CCAGGGAACAGTGGCAGGCTGCTAGCAAGGCAGTGAGAAGCTCTTGGCAGCCAAATGGGT
GCATTCAGGGCTGATTTATAGAGACCCTTGGCTTCTCCTTCTCCTACTCCCTGTCTTTCT
GGCATTTTGTAGCTTGTTAGATTTTCTGCCAGAGGGGTGGGTCAGAGCAGTGGAGGGGAG
ACATCGCCCATGTGCTTCTGCTACTGGTCCTTGGGCTGGGTGGTTGGTAGAGGAGATGTT
GACACTATGAGCTAAGGGTTGGCTTTTGTAATTACCTGAATCTGAAAGGAATGCCTAAGG
TTACCTTGGGGTTTCTCTTCTGGTGAGATAGGGTTCCTGGTTTGAGTAAGTTAATGTCCT
GGATATTTCTTGTGGCAGGGGGTGGTCAAAGAGCCTGATTGCTGACCCAGTCTCAGGCCT
GTGGTCGATGACCTCTCGGTAGTTTCAAAGGGGGCTGGAGGGGGATATTTGACTTGTTTT
TTCGAAATGTAGCCTTCTAACCCTCAAGTCTTTAGAAGCTGGGTGGACTCTTAGTGGTCC
TGCAGCGTATCCTAAAAGACTACCTTTGAAACAGGATTCTTGTATGGCCAGGATCCTGTC
TGGGAACCAGAAACCCTACACCCTCCCCCTCCAGGGAATGCTGAGTTCCAGTTTTGAGCA
GAGGTGAGGCAGAATCCACTGTAGCCTTCCGCCCTGGTATTTGGGGGGATGACCAGCCCA
GGCGTTGGGTGTTAGTCTGCATGAGTTTGTGAGAGGAAATAGCTGGGTGTCCTGGCAGTG
CCCTTGAAGTTGGTTAGGACCTTCCTGTAAACTCTTGCCCCTACTTCTAACTACTCTATA
AATATATACATATATTTATATATAAAGTGATTAGTTGAACTGGCATCCTGCTTTAGCCTG
AGACTTGCCATAAGAAACTGCTGAGTACTTGGCAAACCCTTTCATAGTTTTGTTCTCCAT
CTGTTTGGGGTAGGTGTTGAGCGAGGCAAATGGATCTCGATATTTCAGATGGGCTTTTGA
TGCACTGTTGCCAAGGAAGGCTTTTTCTGATTTTTTGACAAATGAATTTTTGCACACTTT
CATTGGTGTCTTTCGGCAACTTACACACATTGAAAATGAGCTATTGTACATATTTTTATA
TTCTCTTTATAAATGCATGTCTGATTGTACTTGTAACAATATTGTAATGAACGGCTGTGC
AGTAGGCCCAGCGCTGCTGTGTCTCGTCAGAGGAATAGCTTACCACGAACCCCTCAGCAT
ACTGGGAATCTCTTCCTGAACAACGAATGTAAATTTGGTCAAGTCTACTCTTCCGTTCAT
TCAATTATTTTAAGCATTTGAATTATTTATTGTATATCCTAAATATATTTCTCCTTTGGC
AGTGACTAGATTTCCACTAATGTGTCTTAATCTATCCCTCCAGCTGGCAGTTACTGTTTT
TTTAATCCCCTGAAGTTGTCCTGTAGGAGACAGAAATTCTTTGCTGTCTGTATCCCTTGG
AGTAAGAAGGTAGTGGCATGGGTGGAGTGTGTGTTCTTTCTCCAAATCTATTATGATGTT
TATTAAACACTTCTGTAGCAAA
gatggtggtagttcttttgttactgaagttgcccttcaccatggctatttgaaaaggaga
tgtacttggacgtttctgtaaatcttgagataaactgtttggagatttaaccacctctct
gatgggggaccaactctatggaaattgtaaatacgttttatttataaacctggcactgta