Gene BCL11B Variant 2
DNA : 97.63 KbNT_026437
mRNA : 3250 bp NM_138576
CDS : 2685 bp NP_612808
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  325 bp
caaaacccagtttaagttcaagaagacatttgcaagtgcaagaggccaagcagtttgaag
aagtgtaagagattttttttccttcgaaagaatatatttttaaagaaaccagccagtccg
cggaaagcaacagcagttttttttttttttgcctctttttcttattttagatcgagaggt
TTTTCTTGCTTTTCTTCCCTTTTTTTTCTTTTTGCAAACAAAACAAAAAACAGCATAGAA
GAAAGAGCAAAATAAAGAAGAAGAAGAGGAGGAAGAGAGGGAAAGAGAGGAAGGGAAAAA
AAACACCAACCCGGGCAGAGGAGGAGGTGCGGCGGCGGCGGCGGCGGCGGCAGCGGCGGC
AGCGGCGCGGCGGCGGCTCGGACCCCCTCCCCCGGCTCCCCCCATCAGTGCAGCTCTCCG
GGCGATGCCAGAATAGATGCCGGGGCAATGTCCCGCCGCAAACAGGGCAACCCGCAGCAC
TTGTCCCAGAGGGAGCTCATCACCC
gtaagtgtctgcggagtgcgcgcgaggggccggagatggggctccgggcgtctggggctg
gggacaccgagcccggaacagccgagcctggccaggcgccggggccgcccgctggctggc
agagtctacggcgtcggcctggagcatggcggggggcgggggccataggaaagtttcttt
EXON 2  369 bp
tgtcctgtgggggatgctcaccagcccccaaccccggggaggacctggtgagctctggca
gccagcagcagagggggctgcttcttggcggggaaggggtggaccggaagttgggtgctg
tgaccgcctaagcccatctctatcttctctgccccttccctttcttctttctgtctccag
CAGAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGG
AGCCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCC
AGTGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGC
AGTGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCAC
CCTCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCA
CCCCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGA
ACATTGCAG
gtatgggatgctgcgcttgcctggttgctgtggaagccacctcctgggtcccatgccctc
tgcctgagtgtgctggtgcaggggaaggcccaggggcttccaggatggcctctgggccac
cagccggggctccccctttctgagggtccaccatccaggtgaccttcaggaggagacagg
EXON 3  213 bp
cgagcccattccctcgcctgtgtcccgattgccttccctgcagggcctggcaccccgggg
gcctcccacccccgaagggtggcctgagcagagccccacgccccgagccccgtcccaccc
cgtgcccctcacacagtccagggcccgactgaccagtcttttctattgttttttctccag
GGCCGTGCAGGCCTGCCCAGCTGCCAGCGGTGGCCCCCATAGCTGCCTCCTCCCACCCTC
ACTCATCCGTGATCACTTCACCTCTGCGTGCCCTGGGCGCTCTCCCGCCCTGCCTCCCCC
TGCCGTGCTGCAGCGCGCGCCCGGTCTCGGGTGACGGGACTCAGGGTGAGGGTCAGACGG
AGGCTCCCTTTGGATGCCAGTGTCAGTTGTCAG
gtaacagacgacgccgcggtggggggcgggcccccgggatggcggggtgtgccatgggca
gcgctggagcaaggtggggacccagggaggaagggcagctcccacccagaaggctttttg
gggtgccaggggaagtggtaaagaatgttcgctgaactatgagccagggcccggtgcccc
EXON 4  2343 bp
ccagccaggaggagacaaggccgggcctgcttgcaagcggccctgcagcccctgtcaggc
agggcactgggatcccggatcagcccgggccgcgtcccccaggccagtggccctgcggtg
cccgcgccccgctgccgcttctcacgctgtctctgcctttctgtccgtgtgtttccccag
GTAAAGATGAGCCTTCCAGCTACATTTGCACAACATGCAAGCAGCCCTTCAACAGCGCGT
GGTTCCTGCTGCAGCACGCGCAGAACACGCACGGCTTCCGCATCTACCTGGAGCCCGGGC
CGGCCAGCAGCTCGCTCACGCCGCGGCTCACCATCCCGCCGCCGCTCGGGCCGGAGGCCG
TGGCGCAGTCCCCGCTCATGAATTTCCTGGGCGACAGCAACCCCTTCAACCTGCTGCGCA
TGACGGGCCCCATCCTGCGGGACCACCCGGGCTTCGGCGAGGGCCGCCTGCCGGGCACGC
CGCCTCTCTTCAGTCCCCCGCCGCGCCACCACCTGGACCCGCACCGCCTCAGTGCCGAGG
AGATGGGGCTCGTCGCCCAGCACCCCAGTGCCTTCGACCGAGTCATGCGCCTGAACCCCA
TGGCCATCGACTCGCCCGCCATGGACTTCTCGCGGCGGCTCCGCGAGCTGGCGGGCAACA
GCTCCACGCCGCCGCCCGTGTCCCCGGGCCGCGGCAACCCTATGCACCGGCTCCTGAACC
CCTTCCAGCCCAGCCCCAAGTCCCCGTTCCTGAGCACGCCGCCGCTGCCGCCCATGCCCC
CTGGCGGCACGCCGCCCCCGCAGCCGCCAGCCAAGAGCAAGTCGTGCGAGTTCTGCGGCA
AGACCTTCAAGTTCCAGAGCAATCTCATCGTGCACCGGCGCAGTCACACGGGCGAGAAGC
CCTACAAGTGCCAGCTGTGCGACCACGCGTGCTCGCAGGCCAGCAAGCTCAAGCGCCACA
TGAAGACGCACATGCACAAGGCCGGCTCGCTGGCCGGCCGCTCCGACGACGGGCTCTCGG
CCGCCAGCTCCCCCGAGCCCGGCACCAGCGAGCTGGCGGGCGAGGGCCTCAAGGCGGCCG
ACGGTGACTTCCGCCACCACGAGAGCGACCCGTCGCTGGGCCACGAGCCGGAGGAGGAGG
ACGAGGAGGAGGAGGAGGAGGAGGAGGAGCTGCTACTGGAGAACGAGAGCCGGCCCGAGT
CGAGCTTCAGCATGGACTCGGAGCTGAGCCGCAACCGCGAGAACGGCGGTGGTGGGGTGC
CCGGGGTCCCGGGCGCGGGGGGCGGCGCGGCCAAGGCGCTGGCTGACGAGAAGGCGCTGG
TGCTGGGCAAGGTCATGGAGAACGTGGGCCTAGGCGCACTGCCGCAGTACGGCGAGCTCC
TGGCCGACAAGCAGAAGCGCGGCGCCTTCCTGAAGCGTGCGGCGGGCGGCGGGGACGCGG
GCGACGACGACGACGCGGGCGGCTGCGGGGACGCGGGCGCGGGCGGCGCGGTCAACGGGC
GCGGGGGCGGCTTCGCGCCAGGCACCGAGCCCTTCCCCGGGCTCTTCCCGCGCAAGCCCG
CGCCGCTGCCCAGCCCCGGGCTCAACAGCGCCGCCAAGCGCATCAAGGTGGAGAAGGACC
TGGAGCTGCCGCCCGCCGCGCTCATCCCGTCCGAGAACGTGTACTCGCAGTGGCTGGTGG
GCTACGCGGCGTCGCGGCACTTCATGAAGGACCCCTTCCTGGGCTTCACGGACGCACGAC
AGTCGCCCTTCGCCACGTCGTCCGAGCACTCGTCCGAGAACGGCAGCCTGCGCTTCTCCA
CGCCGCCCGGGGACCTGCTGGACGGCGGCCTCTCGGGCCGCAGCGGCACGGCCAGCGGAG
GCAGCACCCCGCACCTGGGCGGCCCGGGCCCCGGGCGGCCCAGCTCCAAGGAGGGCCGCC
GCAGCGACACGTGCGAGTACTGCGGCAAGGTGTTCAAGAACTGCAGCAACTTGACGGTGC
ACCGGCGGAGCCACACCGGCGAGCGGCCTTACAAGTGCGAGCTGTGCAACTACGCGTGCG
CGCAGAGCAGCAAGCTCACGCGCCACATGAAGACGCACGGGCAGATCGGCAAGGAGGTGT
ACCGCTGCGACATCTGCCAGATGCCCTTCAGCGTCTACAGCACCCTGGAGAAACACATGA
AAAAGTGGCACGGCGAGCACTTGCTGACTAACGACGTCAAAATCGAGCAGGCCGAGAGGA
GCTAAGCGCGCGGGCCCCGGCGCCCCGCACCTGTACAGTGGAACCGTTGCCAACCGAGAG
AATGCTGACCTGACTTGCCTCCGTGTCACCGCCACCCCGCACCCCGCGTGTCCCCGGGGC
CCAGGGGAGGCGGCACTCCAACCTAACCTGTGTCTGCGAAGTCCTATGGAAACCCGAGGG
TTGATTAAGGCAGTACAAATTGTGGAGCCTTTTAACTGTGCAATAATTTCTGTATTTATT
GGGTTTTGTAATTTTTTTGGCATGTGCAGGTACTTTTTATTATTATTTTTTCTGTTTGAA
TTC
ctttaagagattttgttgggtatccatcccttctttgttttttttttaacccggtagtag
cctgagcaatgactcgcaagcaatgttagaggggaagcatatcttttaaattataatttg
gggggaggggtggtgctgcttttttgaaatttaagctaagcatgtgtaatttcttgtgaa