Gene BCL11B Variant 1
DNA : 102.20 KbNT_026437
mRNA : 7603 bp NM_022898
CDS : 2472 bp NP_075049
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  325 bp
caaaacccagtttaagttcaagaagacatttgcaagtgcaagaggccaagcagtttgaag
aagtgtaagagattttttttccttcgaaagaatatatttttaaagaaaccagccagtccg
cggaaagcaacagcagttttttttttttttgcctctttttcttattttagatcgagaggt
TTTTCTTGCTTTTCTTCCCTTTTTTTTCTTTTTGCAAACAAAACAAAAAACAGCATAGAA
GAAAGAGCAAAATAAAGAAGAAGAAGAGGAGGAAGAGAGGGAAAGAGAGGAAGGGAAAAA
AAACACCAACCCGGGCAGAGGAGGAGGTGCGGCGGCGGCGGCGGCGGCGGCAGCGGCGGC
AGCGGCGCGGCGGCGGCTCGGACCCCCTCCCCCGGCTCCCCCCATCAGTGCAGCTCTCCG
GGCGATGCCAGAATAGATGCCGGGGCAATGTCCCGCCGCAAACAGGGCAACCCGCAGCAC
TTGTCCCAGAGGGAGCTCATCACCC
gtaagtgtctgcggagtgcgcgcgaggggccggagatggggctccgggcgtctggggctg
gggacaccgagcccggaacagccgagcctggccaggcgccggggccgcccgctggctggc
agagtctacggcgtcggcctggagcatggcggggggcgggggccataggaaagtttcttt
EXON 2  369 bp
tgtcctgtgggggatgctcaccagcccccaaccccggggaggacctggtgagctctggca
gccagcagcagagggggctgcttcttggcggggaaggggtggaccggaagttgggtgctg
tgaccgcctaagcccatctctatcttctctgccccttccctttcttctttctgtctccag
CAGAGGCTGACCATGTGGAGGCCGCCATCCTCGAAGAAGACGAGGGTCTGGAGATAGAGG
AGCCAAGTGGCCTGGGGCTGATGGTGGGTGGCCCCGACCCTGACCTGCTCACCTGTGGCC
AGTGTCAAATGAACTTCCCCTTGGGGGACATCCTGGTTTTTATAGAGCACAAAAGGAAGC
AGTGTGGCGGCAGCTTGGGTGCCTGCTATGACAAGGCCCTGGACAAGGACAGCCCGCCAC
CCTCCTCACGCTCCGAGCTCAGGAAAGTGTCCGAGCCGGTGGAGATCGGGATCCAAGTCA
CCCCCGACGAAGATGACCACCTGCTCTCACCCACGAAAGGCATCTGTCCCAAGCAGGAGA
ACATTGCAG
gtatgggatgctgcgcttgcctggttgctgtggaagccacctcctgggtcccatgccctc
tgcctgagtgtgctggtgcaggggaaggcccaggggcttccaggatggcctctgggccac
cagccggggctccccctttctgagggtccaccatccaggtgaccttcaggaggagacagg
EXON 3  6909 bp
ccagccaggaggagacaaggccgggcctgcttgcaagcggccctgcagcccctgtcaggc
agggcactgggatcccggatcagcccgggccgcgtcccccaggccagtggccctgcggtg
cccgcgccccgctgccgcttctcacgctgtctctgcctttctgtccgtgtgtttccccag
GTAAAGATGAGCCTTCCAGCTACATTTGCACAACATGCAAGCAGCCCTTCAACAGCGCGT
GGTTCCTGCTGCAGCACGCGCAGAACACGCACGGCTTCCGCATCTACCTGGAGCCCGGGC
CGGCCAGCAGCTCGCTCACGCCGCGGCTCACCATCCCGCCGCCGCTCGGGCCGGAGGCCG
TGGCGCAGTCCCCGCTCATGAATTTCCTGGGCGACAGCAACCCCTTCAACCTGCTGCGCA
TGACGGGCCCCATCCTGCGGGACCACCCGGGCTTCGGCGAGGGCCGCCTGCCGGGCACGC
CGCCTCTCTTCAGTCCCCCGCCGCGCCACCACCTGGACCCGCACCGCCTCAGTGCCGAGG
AGATGGGGCTCGTCGCCCAGCACCCCAGTGCCTTCGACCGAGTCATGCGCCTGAACCCCA
TGGCCATCGACTCGCCCGCCATGGACTTCTCGCGGCGGCTCCGCGAGCTGGCGGGCAACA
GCTCCACGCCGCCGCCCGTGTCCCCGGGCCGCGGCAACCCTATGCACCGGCTCCTGAACC
CCTTCCAGCCCAGCCCCAAGTCCCCGTTCCTGAGCACGCCGCCGCTGCCGCCCATGCCCC
CTGGCGGCACGCCGCCCCCGCAGCCGCCAGCCAAGAGCAAGTCGTGCGAGTTCTGCGGCA
AGACCTTCAAGTTCCAGAGCAATCTCATCGTGCACCGGCGCAGTCACACGGGCGAGAAGC
CCTACAAGTGCCAGCTGTGCGACCACGCGTGCTCGCAGGCCAGCAAGCTCAAGCGCCACA
TGAAGACGCACATGCACAAGGCCGGCTCGCTGGCCGGCCGCTCCGACGACGGGCTCTCGG
CCGCCAGCTCCCCCGAGCCCGGCACCAGCGAGCTGGCGGGCGAGGGCCTCAAGGCGGCCG
ACGGTGACTTCCGCCACCACGAGAGCGACCCGTCGCTGGGCCACGAGCCGGAGGAGGAGG
ACGAGGAGGAGGAGGAGGAGGAGGAGGAGCTGCTACTGGAGAACGAGAGCCGGCCCGAGT
CGAGCTTCAGCATGGACTCGGAGCTGAGCCGCAACCGCGAGAACGGCGGTGGTGGGGTGC
CCGGGGTCCCGGGCGCGGGGGGCGGCGCGGCCAAGGCGCTGGCTGACGAGAAGGCGCTGG
TGCTGGGCAAGGTCATGGAGAACGTGGGCCTAGGCGCACTGCCGCAGTACGGCGAGCTCC
TGGCCGACAAGCAGAAGCGCGGCGCCTTCCTGAAGCGTGCGGCGGGCGGCGGGGACGCGG
GCGACGACGACGACGCGGGCGGCTGCGGGGACGCGGGCGCGGGCGGCGCGGTCAACGGGC
GCGGGGGCGGCTTCGCGCCAGGCACCGAGCCCTTCCCCGGGCTCTTCCCGCGCAAGCCCG
CGCCGCTGCCCAGCCCCGGGCTCAACAGCGCCGCCAAGCGCATCAAGGTGGAGAAGGACC
TGGAGCTGCCGCCCGCCGCGCTCATCCCGTCCGAGAACGTGTACTCGCAGTGGCTGGTGG
GCTACGCGGCGTCGCGGCACTTCATGAAGGACCCCTTCCTGGGCTTCACGGACGCACGAC
AGTCGCCCTTCGCCACGTCGTCCGAGCACTCGTCCGAGAACGGCAGCCTGCGCTTCTCCA
CGCCGCCCGGGGACCTGCTGGACGGCGGCCTCTCGGGCCGCAGCGGCACGGCCAGCGGAG
GCAGCACCCCGCACCTGGGCGGCCCGGGCCCCGGGCGGCCCAGCTCCAAGGAGGGCCGCC
GCAGCGACACGTGCGAGTACTGCGGCAAGGTGTTCAAGAACTGCAGCAACTTGACGGTGC
ACCGGCGGAGCCACACCGGCGAGCGGCCTTACAAGTGCGAGCTGTGCAACTACGCGTGCG
CGCAGAGCAGCAAGCTCACGCGCCACATGAAGACGCACGGGCAGATCGGCAAGGAGGTGT
ACCGCTGCGACATCTGCCAGATGCCCTTCAGCGTCTACAGCACCCTGGAGAAACACATGA
AAAAGTGGCACGGCGAGCACTTGCTGACTAACGACGTCAAAATCGAGCAGGCCGAGAGGA
GCTAAGCGCGCGGGCCCCGGCGCCCCGCACCTGTACAGTGGAACCGTTGCCAACCGAGAG
AATGCTGACCTGACTTGCCTCCGTGTCACCGCCACCCCGCACCCCGCGTGTCCCCGGGGC
CCAGGGGAGGCGGCACTCCAACCTAACCTGTGTCTGCGAAGTCCTATGGAAACCCGAGGG
TTGATTAAGGCAGTACAAATTGTGGAGCCTTTTAACTGTGCAATAATTTCTGTATTTATT
GGGTTTTGTAATTTTTTTGGCATGTGCAGGTACTTTTTATTATTATTTTTTCTGTTTGAA
TTCCTTTAAGAGATTTTGTTGGGTATCCATCCCTTCTTTGTTTTTTTTTTAACCCGGTAG
TAGCCTGAGCAATGACTCGCAAGCAATGTTAGAGGGGAAGCATATCTTTTAAATTATAAT
TTGGGGGGAGGGGTGGTGCTGCTTTTTTGAAATTTAAGCTAAGCATGTGTAATTTCTTGT
GAAGAAGCCAACACTCAAATGACTTTTAAAGTTGTTTACTTTTTCATTCCTTCCTTTTTT
TTGTCCTGAAATAAAAAGTGGCATGCAGTTTTTTTTTTAATTATTTTTTAATTTTTTTTT
TGGTTTTTGTTTTTGGGGTGGGGGGTGTGGATGTACAGCGGATAACAATCTTTCAAGTCG
TAGCACTTTGTTTCAGAACTGGAATGGAGATGTAGCACTCATGTCGTCCCGAGTCAAGCG
GCCTTTTCTGTGTTGATTTCGGCTTTCATATTACATAAGGGAAACCTTGAGTGGTGGTGC
TGGGGGAGGCACCCCACAGACTCAGCGCCGCCAGAGATAGGGTTTTTGGAGGGCTCCTCT
GGGAAATGGCCCGACAGCATTCTGAGGTTGTGCATGACCAGCAGATACTATCCTGTTGGT
GTGCCCTGGGGTGCCATGGCTGCTATTCGCTGTAGATTAGGCTACATAAAATGGGCTGAG
GGTACCTTTTTGGGGAGATGGGGTGGCCTGCAGTGACACAGAAAGGAAGAAACTAGCGGT
GTTCTTTTAGGCGTTTTCTGGCTTGACGGCTTCTCTCTTTTTTTAAATCACCCCCACCAC
ATAAATCTCAAATCCTATGTTGCTACAAGGGGTCATCCATCATTTCCCAAGCAGACGAAT
GCCCTAATTAATTGAAGTTAGTGTTCTCTCATTTAATGCACACTGATGATATTGTAGGGA
TGGGTGGGGTGGGGATCTTGCAAATTTCTATTCTCTTTTACTGAAAAAGCAGGGGATGAG
TTCCATCAGAAGGTGCCCAGCGCTACTTCCCAGGTTTTTATTTTTTTTTTCCTATCTCAT
TAGGTTGGAAGGTACTAAATATTGAACTGTTAAGATTAGACATTTGAATTCTGTTGACCC
GCACTTTAAAGCTTTTGTTTGCATTTAAATTAAATGGCTTCTAAACAAGAAATTGCAGCA
TATTCTTCTCTTTGGCCCAGAGGTGGGTTAAACTGTAAGGGACAGCTGAGATTGAGTGTC
AGTATTGCTAAGCGTGGCATTCACAATACTGGCACTATAAAGAACAAAATAAAATAATAA
TTTATAGGACAGTTTTTCTACTGCCATTCAATTTGATGTGAGTGCCTTGAAAACTGATCT
TCCTATTTGAGTCTCTTGAGACAAATGCAAAACTTTTTTTTTGAAATGAAAAGACTTTTT
AAAAAAGTAAAACAAGAAAAGTACATTCTTTAGAAACTAACAAAGCCACATTTACTTTAA
GTAAAAAAAAAAAAAATTCTGGTTGAAGATAGAGGATATGAAATGCCATAAGACCCAATC
AAATGAAGAAATAAACCCAGCACAACCTTGGACATCCATTAGCTGAATTATCCTCAGCCC
CTTTTGTTTTTGGGACAACGCTGCTTAGATATGGAGTGGAGGTGATTTACTGCTGAATTA
AAACTCAAGTGACACAAGTTACAAGTTGATATCGTTGAATGAAAAGCAAAACAAAAACAA
TTCAGGAACAACGGCTAATTTTTTCTAAAGTTAAATTTAGTGCACTCTGTCTTAAAAATA
CGTTTACAGTATTGGGTACATACAAGGGTAAAAAAAAAATTGTGTGTATGTGTGTTGGAG
CGATCTTTTTTTTTCAAAGTTTGCTTAATAGGTTATACAAAAATGCCACAGTGGCCGCGT
GTATATTGTTTTCTTTTGGTGACGGGGTTTTAGTATATATTATATATATTAAAATTTCTT
GATTACTGTAAAAGTGGACCAGTATTTGTAATAATCGAGAATGCCTGGGCATTTTACAAA
ACAAGAAAAAAAATACCCTTTTCTTTTCCTTGAAAATGTTGCAGTAAAATTTAAATGGTG
GGTCTATAAATTTGTTCTTGTTACAGTAACTGTAAAGTCGGAGTTTTAGTAAATTTTTTT
CTGCCTTGGGTGTTGAATTTTTATTTCAAAAAAAATGTATAGAAACTTGTATTTGGGGAT
TCAAAGGGGATTGCTACACCATGTAGAAAAAGTATGTAGAAAAAAAGTGCTTAATATTGT
TATTGCTTTGCAGAAAAAAAAAAAATCACATTTCTGACCTGTACTTATTTTTCTCTTCCC
GCCTCCCTCTGGAATGGATATATTGGTTGGTTCATATGATGTAGGCACTTGCTGTATTTT
TACTGGAGCTCGTAATTTTTTAACTGTAAGCTTGTCCTTTTAAAGGGATTTAATGTACCT
TTTTGTTAGTGAATTTGGAAATAAAAAGAAAAAAAAAACAAAAACAAACAGGCTGCCATA
ATATATTTTTTTAATTTGGCAGGATAAAATATTGCAAAAAAAACACATTTGTATGTTAAG
TCCTATTGTACAGGAGAAAAAGGGTTGTTTGACAACCTTTGAGAAAAAGAAACAAAAGGA
AGTAGTTAAATGCTTTGGTTCACAAATCATTTAGTTGTATATATTTTTTGTCGGAATTGG
CCTACACAGAGAACCGTTCGTGTTGGGCTTCTCTCTGAACGCCCCGAACCTTGCATCAAG
GCTCCTTGGTGTGGCCACAGCAGACCAGATGGGAAATTATTTGTGTTGAGTGGAAAAAAA
TCAGTTTTTGTAAAGATGTCAGTAACATTCCACATCGTCCTCCCTTTCTCTAAGAGGCCA
TCTCTAAGATGTCAGATGTAGAGGAGAGAGAGCGAGAGAACATCTTCCTTCTCTACCATC
ACTCCTGTGGCGGTCACCACCACCACCTCTCCCGCCCTTACCAGCAGAAAGCAATGCAAA
CTGAGCTGCTTTAGTCCTTGAGAAATTGTGAAACAAACACAAATATCATAAAAGGAGCTG
GTGATTCAGCTGGGTCCAGGTGAAGTGACCTGCTGTTGAGACCGGTACAAATTGGATTTC
AGGAAGGAGACTCCATCACAGCCAGGACCTTTCGTGCCATGGAGAGTGTTGGCCTCTTGT
CTTTCTTCCCTGCTTTGCTGCTTTGCTCTCTGAAACCTACATTCCGTCAGTTTCCGAATG
CGAGGGCCTGGGATGAATTTGGTGCCTTTCCATATCTCGTTCTCTCTCCTTCCCCTGCGT
TTCCTCTCCATCCTTCATCCTCCATTGGTCCTTTTTTTTTCTTTCATTTTTTATTTAATT
TCTTTTCTTCCTGTCTGTTCCTCCCCTAATCCTCTATTTTATTTTTATTTTTTGTAAAGC
CAAGTAGCTTTAAGATAAAGTGGTGGTCTTTTGGATGAGGGAATAATGCATTTTTAAATA
AAATACCAATATCAGGAAGCCATTTTTTATTTCAGGAAATGTAAGAAACCATTATTTCAG
GTTATGAAAGTATAACCAAGCATCCTTTTGGGCAATTCCTTACCAAATGCAGAAGCTTTT
CTGTTCGATGCACTCTTTCCTCCTTGCCACTTACCTTTGCAAAGTTAAAAAAAAGGGGGG
AGGGAATGGGAGAGAAAGCTGAGATTTCAGTTTCCTACTGCAGTTTCCTACCTGCAGATC
CAGGGGCTGCTGTTGCCTTTGGATGCCCCACTGAGGTCCTAGAGTGCCTCCAGGGTGGTC
TTCCTGTAGTCATAACAGCTAGCCAGTGCTCACCAGCTTACCAGATTGCCAGGACTAAGC
CATCCCAAAGCACAAGCATTGTGTGTCTCTGTGACTGCAGAGAAGAGAGAATTTTGCTTC
TGTTTTGTGTTTAAAAAACCAACACGGAAGCAGATGATCCCGAGAGAGAGGCCTCTAGCA
TGGGTGACCCAGCCGACCTCAGGCCGGTTTCCGCACTGCCACAACTTTGTTCAAAGTTGC
CCCCAATTGGAACCTGCCACTTGGCATTAGAGGGTCTTTCATGGGGAGAGAAGGAGACTG
AATTACTCTAAGCAAAATGTGAAAAGTAAGGAAATCAGCCTTTCATCCCGGTCCTAAGTA
ACCGTCAGCCGAAGGTCTCGTGGAACACAGGCAAACCCGTGATTTTGGTGCTCCTTGTAA
CTCAGCCCTGCAAAGCAAAGTCCCATTGATTTAAGTTGTTTGCATTTGTACTGGCAAGGC
AAAATATTTTTATTACCTTTTCTATTACTTATTGTATGAGCTTTTGTTGTTTACTTGGAG
GTTTTGTCTTTTACTACAAGTTTGGAACTATTTATTATTGCTTGGTATTTGTGCTCTGTT
TAAGAAACAGGCACTTTTTTTTATTATGGATAAAATGTTGAGATGACAGGAGGTCATTTC
AATATGGCTTAGTAAAATATTTATTGTTCCTTTATTCTCTGTACAAGATTTTGGGCCTCT
TTTTTTCCTTAATGTCACAATGTTGAGTTCAGCATGTGTCTGCCATTTCATTTGTACGCT
TGTTCAAAACCAAGTTTGTTCTGGTTTCAAGTTATAAAAATAAATTGGACATTTAACTTG
ATCTCCAAA
ccttgtccttttctgtgtcttttaaaggtgggggatggacagcttatttccaagggcaaa
ttgaaagtctttctccattttcttcctgacccaaatctttaagcccatcgagaggatgac
aggaaatcatggcacgagagccctatagttctcttagctcctgtgcagcagtgtgatcta