Gene ACTR10 Variant 1
DNA : 34.66 KbNT_026437
mRNA : 1585 bp NM_018477
CDS : 1254 bp NP_060947
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  157 bp
ggcctccgcgcccccgcactcggattcgcgcccgccagcgcctcttttcccctagtcctg
gcgacggcagcacctgcaagggtgggtccaacgcggaatgaggcacagcctgggacagcc
cgggcccggcgcgccgcggccgcgcgaggcccccgccgtcgccgacgcccgagcgccgga
GCCCCGGCCCCGCCCCGCGAGCGCCGAGACTTGTTGGCCGCGGAGACTGCGACCCTCTTC
TCTCAGTCTGCCTTACTACCATGCCGCTCTACGAGGGCCTGGGGAGCGGCGGGGAGAAGA
CGGCGGTCGTGATCGACCTGGGAGAGGCCTTTACCAA
gtgagtggccgtgacgccagctgtgttcgacccgaggggagggcgggtggcagagcccca
ggcactgcctgggtcctcatcgccgactcgctgggcagctccgggcctccccttttcttc
aaccagcgcccttgcaaataacagctcttattatttcctccctgggcgatgcgaatccga
EXON 2  73 bp
gcattaataaatagtattattagttttgtggagtgattttttttgatcccttaaaataca
tcaggtattttcaaatgttattgtggccattgttttgaaacaaatacagagaaaattagt
ttctgtgacaaatatttaaaagaatactataagttgtttcaattttccatttatttgcag
GTGTGGATTTGCTGGAGAAACTGGTCCAAGATGTATAATTCCTAGTGTGATAAAAAGAGC
TGGGATGCCTAAG
gtatttaaaaaaaaatattagcaaaataaatgccatactataaaatgttttaaaatatga
cttcaagtaagattgattaaaacagtactaaaggccagccgtggtggctcacgcctgtaa
tcccaacactttgggtggctgaggcgggtggatcacctgagatcaggagtttgagaccag
EXON 3  83 bp
acattccgattcttaaggattcctaatttaagagattactctgtatttaatttttatatt
ctcaatacagattgcttttaatttattcccagaaaatgtattagtaaataattacatttt
aatcttaatttgaggttattttattaatataaattaataaatcattttaattttttacag
CCTGTCAGAGTTGTTCAGTATAATATCAATACAGAAGAATTATATTCCTACCTAAAGGAA
TTCATCCACATACTATATTTCAG
gtaagatacattttgttttctagcttttatgattagatagattttcctaatgccatagtg
ataattggttgtgttacagctgaggccaaaaaaaaaaaaaatggacttctattgccattt
ttacatgcttattttcaaccttttcaaaaatatatttgaagactagaaaactggcagaca
EXON 4  109 bp
actgcacggtacatagtaagaggtcagaaatgttatctttctggggtaataaaatgaaga
tgtctttttgtgataaaatatcttaagctaaggtagtacagtttcactgttcttaaattg
tatgacttaacaaaatgaataaaaacttttacttttaaaaccaaaactttcacttttcag
GCATCTATTGGTGAATCCCAGAGACCGCCGAGTTGTGATTATCGAATCGGTATTATGTCC
TTCTCACTTCAGAGAGACACTCACTCGTGTTCTTTTCAAATATTTTGAG
gtacctgtctttatatcaaataagtaaattgcttttgaaataaaaagagaagcaataaaa
ttcttaccaatttttagggaatctttcttctctttttttttgttggtaggtactcaaaac
ttaaactaataaaagcccttattttgtctcatattgtgtatggcacacagtgtagttggg
EXON 5  108 bp
atttatataaatcaacaaactagttcttaattactctcataaaatggttgagtaggtatc
accatataaattaatataatgttcctgtgaattttttcaaatatatttggatataaggca
aataccttcaaataatgacactcattccggttttgttgtattgattttgttattttctag
GTTCCATCTGTCTTGCTTGCTCCAAGTCATCTAATGGCTCTTCTGACGCTTGGAATTAAT
TCTGCCATGGTCCTAGATTGTGGATATAGGGAAAGCCTGGTGTTACCC
atatcttttttgtcagccagccacctttgcagtttttactctactttaactaaaataatt
aggctaattataaatgatttgtattgtactgaactattttgggttactatgtacaaatat
gaattacaatgtggaaaaagttcacaggattataagacttaagtttactttttgtagaag
EXON 6  68 bp
ttctttgatgaagaacatgaaaaaaaacttactctttgatttttctgtaactatgttaaa
aataagaaataaaaatttgtcactaaagcatatttagaacagtactgcagaaggtgagga
aaatatcaaggaaaccacattttatctcctaaaatagtagtatccttgactactctatag
ATATATGAAGGAATCCCAGTTCTAAATTGTTGGGGAGCACTACCCCTAGGAGGAAAAGCT
CTTCACAA
gtaagtttcttggaatttaacatattcatttcacctgtgccacaaaaacagttgctaatc
tgtttgttgatcagtgatcaatagagggcttgtgatacggacagtgaattttattcattc
cgccctctattagcttcgagtatattcattttttaagaataaaccagttttttaaatttt
EXON 7  80 bp
gaacctaggaggtgaatgttgcagtgaactgggattgcgccacttcactccagcctgggc
aacagagtaagactgtctccaaaaaaaaaatcataataatctattatgtagttgaaagta
tcaaataaggatatcagtttcaatattttcattccagtaactttttttttttaatttcag
AGAGTTGGAAACTCAACTATTGGAACAATGTACTGTTGACACAAGTGTTGCTAAAGAACA
GAGCCTTCCCTCAGTGATGG
gtaaattcattttaagtggtttaggagtggtttacactctctttttgttcttcaacttgt
attttagtctttgctccattgcatgattattctcttttctccccatgccactctgatggt
actgcttcaactataagctcaccattgaacttttaatcactaaattcaatagtttgattt
EXON 8  36 bp
gaatgatgatatttcttccctaaaacaaaattaaatttttctgttagactttttgagaaa
attatagtagttgtatttttaaaattttttctaaattgaaaaatagaaatgtgaaggcaa
tttaatagactgtttttaattattaaagttttataattctaaatgaaatatttgttttag
GTTCAGTTCCGGAAGGTGTCTTAGAGGACATTAAAG
gtaaactaagttctcatttttgtccctttcatccttaagtgttactttggagggcatatg
cttctaaacatttacacagatagaaaatatattcataatgtaatatcctaaaagtattta
atatataggttatgggatactctaagtacaaattccacttttttttcacacttagggaag
EXON 9  80 bp
caggttttttaatgaacaaattattgttagctaactaaagatgggaatagagtttataaa
atccaaaggaatagatgatgagcatgttcacttgaatagaattgttttaactggggtgta
ggtacactctgttcaattataataactagccataataaggtctccttttcttccttaaag
CGCGTACTTGCTTTGTAAGTGATCTGAAGCGAGGACTAAAAATCCAAGCAGCAAAATTTA
ATATTGATGGGAATAATGAG
gtaagtttaaaaaaaaaaaaggcatctttttgcaaaggttacaacatgtgtggacttatg
tttatgatatttatatttcagcgtccctccccacccccaaatgttgactatccattagat
ggagagaagattttacatatccttggatcaatcaggttagatcttaaatttttacggcaa
EXON 10  74 bp
ctccttttcttccttaaagcgcgtacttgctttgtaagtgatctgaagcgaggactaaaa
atccaagcagcaaaatttaatattgatgggaataatgaggtaagtttaaaaaaaaaaaag
gcatctttttgcaaaggttacaacatgtgtggacttatgtttatgatatttatatttcag
CGTCCCTCCCCACCCCCAAATGTTGACTATCCATTAGATGGAGAGAAGATTTTACATATC
CTTGGATCAATCAG
gttagatcttaaatttttacggcaaagtagtaaactaaaataaacttttggcttttaaaa
atatttgtatgagcctttatttcactattgccattttaacagttcagtgtttattgttaa
gcctcattattcatgattaattttattcagctttttttttttgagacaaggtcttgctgt
EXON 11  82 bp
gaggcaggcattgttatcctctccatttacaaatgagaacaccttgtattttaataatta
ttctttgttaatgtagtattggtacttaaaaatactatgtaaatggaaataatggtgtat
tctgtgtaatattataatacgtgacaccaacagaaagctctctttttcaaatcccattag
AGATTCAGTTGTGGAAATTCTTTTTGAACAAGATAATGAAGAGCAATCAGTTGCCACTTT
AATATTGGATTCCCTTATACAG
gtattttatcttgtcaaaaaattccctttattaccacagtcctttaaatataaattttaa
atgttattttaggcaactagcaatccttgtcacatattatttttaatatgtgtcaacaac
taatctgcttattaaattttattaatttttacagaatacggtccttttttaactttttaa
EXON 12  202 bp
ttgctacatgaaagaaaccttgctgtggccctttttgcgatacaaacgatcacctgttta
atctgtagtataataataatatgtataataatagtatatttatgtatattttcttaagtt
caatcaagcattatttgtacagttcagaataaatccttctttttttctttttaataacag
TGTCCGATAGACACCAGGAAGCAACTAGCAGAGAATTTGGTAGTCATAGGTGGCACTTCT
ATGTTGCCAGGATTTCTCCACAGATTGCTTGCAGAAATAAGGTATTTGGTAGAAAAACCA
AAATATAAAAAAGCACTTGGCACTAAGACATTTCGAATTCATACTCCACCTGCAAAAGCT
AATTGTGTGGCCTGGTTGGGAG
gtaagaatttcacttttaaaatataatgattatatagtatttggtctctgaatgacacta
ttaatggatatattagaataaataattcagggttcagaattgcccactttataaatagaa
ctaacactgactttttctttttttttttttttttttttttttttgagacggagtctcact
EXON 13  433 bp
cctgttattcaaaatgtaaaataaagaatggcttaactggaattactttgaagattgtgg
ctatgcattgctgaattttaccagtccacttttgtcatatagtgaagtagatgtatgtgt
acataaagttttctggtaaaagttttcatcttagctataaaaaatatttttgtcacacag
GGGCTATTTTTGGAGCATTACAAGATATACTTGGGAGCCGTTCTGTTTCAAAGGAATATT
ATAATCAGACGGGCCGTATACCTGATTGGTGTTCTCTCAATAACCCACCTTTGGAAATGA
TGTTTGATGTCGGGAAAACTCAACCACCTCTGATGAAGAGAGCATTTTCCACTGAGAAAT
AGAAGTTTGATTAAAAATCAACCTTGCTTCATATCAAATATTTAACCAATTATAAGCAAA
TTGTACAAAGTATGTAGGATGTTTTGTTATAGAGGACTATAGTGGAAGTGAAAGCATTCT
GTGTTTACTCTTTGCATTAATATATAATTCTTTTGACTTTGTTTCTCTTGTGTAGTGGTA
AAATGGTAGCTGGTGCTTATTGAGATTTGCTGTATTTATATCAATAAAGTATAGTAAAGC
AGTTTGATTTTGG
aagtttgttatgtggctttttttttttttttttttttgagacggagtctcgctctgtcac
ttaggctggagtgcagtggcacaatctctactcattgcaagctccgcctcccgggtttac
gccattctgtctcagcctcctgagtagctgggactataggcatacgccaccccgcccggc