--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (72461 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (37 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1821       2014   0    Initial    194    84        Good
caagcaagtcccgcctttcccaggcggaccagtagttgctgctttgtcttaatacagtgc
cttctgtttcttctcactggcgttgtgttgtttctaggaggtactccgcgaatgagaaca
ttgagaatgtgttcggcataactcatttctttgtatctccctgcactctgtgctgggaaa
ATGAATCATCCATTTGGAAAAGAGGAAGCTGCTTCGCAGAAGCAGCTTTTTGGATTTTTC
TGCGAATGCCTGCGGAGGGGAGAATGGGAGCTGGCACAGGCATGTGTACCTCAGCTACAG
GAGGGACAAGGGGATATCCCAAAGAGGGTAGAAGACATACTTCAGGCATTGGTGGTGTGT
CCAAATCTGCTGAG
gtaagggatctcttttcctaccagacggtcccagggtgagagacatgtggttcaatattt
gggcattggtcaatgtgcccccactcaactaccctctgaagaataagcagaggcacagtg
tatttcacgtgctctgaaattttacctctatagtatacatccattacttagtcaatattg

Exon  2 +       3720       3798   2   Internal     79    65    Marginal
gcctggcctggttccaatgttttactgaactgtcatatacatttaaaaatatctcattag
ggcagtgtcttgcctgttcaggtttaaaacagaataagcaatgaaatctgtcttggatga
caaaagatgaaagatcagtagaaactcttttttacaagtctttctttttacctttttcag
ATGTGGGCAGGACATCAACCCTCAAAGAGTAGCCTGGGTCTGGCTTCTTGTACTGGAGAA
ATGGTTGGCCCGGGAAAAG
gtaagtaggtttatattaaattttcctccgaggccaggactgagaagaacttgaaagtag
ttgtgggatttcccttctgtctgttacttcctttatcattaaattcatcatactcattct
caaagaatggcttaaatttttattgctgtctccttacctaaattcattcattaatgcact

Exon  3 +       8495       8584   0   Internal     90   100   Excellent
gcctggggaacagagcaagactctgtctcaaaataaaaaaaaaaaaaaaaaaaaaaaaaa
agagtgcttcatcttagagaaatagcagaaataagactaactggacagaaatatttaatt
ataatttgttaactaaaacatatatctcatctctatgcttcattcttttgattcttctag
AAGTTACTCCCAGTTGTTTTCCGGAGAAAGCTTGAGTTTCTTTTATTGTCAGAAGACCTC
CAAGGTGACATTCCAGAGAACATCCTCGAG
gtgagagagagccctggtaccatctgcccagggttgacagtcacttaagcagcttagctt
ccatggacccagaagagagaggtctccaagatgttgcccatactttgttctcaggcaagg
caacacagaagctcctttgaggagagtttagagttagggtaaacttatatgattttagaa

Exon  4 +       9864      10386   0   Internal    523    68    Marginal
atttgatttttctgtgtaaagggccttagaacaatgtctaacacatagtaactacgacat
aagtatttgttaccgccactattatataagtaaactgaaaaagaggaaagcatgaaggca
cacaagtgataccattccaggcatgcccaccacccatccttttcttcatcctctatttag
GAGCTGTATGAGACCTTAACACAGGGTGCAGTAGGCCACGTGCCTGACGGAAATCCAAGG
AGGGAGAGCTGGACTCCTCGTCTCAGCTCCGAAGCTGTCTCTGTGCTCTGGGATCTCCTG
AGGCAGTCTCCCCAGCCAGCACAGGCCCTGCTGGAGCTCCTGCTTGAGGAGGATGACGGT
ACTGGCCTCTGTCACTGGCCTCTGCAGAATGCACTGGTGGACCTCATTCGAAAGGCATTG
CGGGCTTTGCAGGGCCCTGATTCGGTGCCCCCTGGGGTAGTCGATGCCATCTATGGAGCC
CTGCGGACTCTGCGTTGCCCCGCAGAACCACTTGGGGTTGAGTTGCATCTCCTGTGTGAG
GAACTACTAGAGGCCTGCAGGACCGAGGGGAGTCCCCTGCGGGAGGAGCGGCTGCTCAGC
TGCCTGCTGCACAAGGCCAGCCGGGGCCTGCTGTCCCTGTATGGCCATACCTATGCAGAG
AAGGTCACAGAAAAGCCACCGAGGGCTACAGCCTCGGGAAAAG
gtgtgttccctttgctgctgctcctttagtttcagtaattccagtatgcccagccttgct
ggaggctctagactgctgccttccgtgtggctcaggacatctaataggggaggctaagca
aaaatgggtgcgatgctctttcgtaaaagtacaggcctggcatggtggctcaggcctgta

Exon  5 +      11109      11239   1   Internal    131    95   Excellent
gcttttctgaagctcccaagggaagtaaagattctttaagataccctaagataaagtatg
gaaaacccagcctaagtttttaaaagagcaaactctcacatcacttggttgttcaaatgg
gctctagcttagaaaagaagagttcttggtttcctgataaccgtcttgtttgatgttcag
TCTCACCGGATCATCTAGATCCTGAGCGGGCAATGCTAGCCCTGTTCTCCAATCCCAACC
CAGCCGAGGCTTGGAAAGTGGCCTATTTCTACTGCCTGAGCAACAACAAACACTTCCTCG
AGCAGATTCTG
gtaagtcaagcttaattgttcatcacagaggtacccagggattctccccagactttttca
ttcctcatttctctcccactcatttggccaccataaagcagtctaattagtgttgagtca
tttggttttgtccctcccacagtcccatgggaaaggagactctgagaatcagtgccattc

Exon  6 +      12479      12567   0   Internal     89    56    Marginal
agaggctgctccagaccctgcacaggacccaggtaactctcactcagcatcccaggctgc
tctggaagtgagagacgtggggcttcgggcttaggctgaatgcagagccctaaaatcagt
cataatctgtaaccccaggtgcctgagtcagcatctctttcttctcccatatcaacatag
GGCCCAGGCTGTGATGAGCTCCTCAGGGATGCCTGTGATGGGTTGTGGGCTCACCTGGAG
GTCCTGGAGTGGTGCATACAGCAGAGCAG
gtatggccctgtgcagtcagcgcctgcccaccacagggcacagctgaccctgtgctccgc
atgtgtggccatttcaaggcgttttccacataaatgttttgagttggcaatgttgaccag
ctactaaaaattgttccaacaattaaaccaagaaagaaacacaagtaattattaccttca

Exon  7 +      13520      13683   2   Internal    164    87        Good
ttccctgagggtaaataaatgttaggctcagtcccaaaccaactaaaatttagattgtag
ggaagggaagcctgtggcattatggtccagagaggaagaacaagagggaatggagattga
tctttcttcgagcaataatataaactgcctctcttccatcctcccaacttttccattcag
CAACCCCATACCAAAGAGAGATCTGTTGTATCATTTACACGGTGGAGACAGCCACTCAGT
GCTCTACACTCTCCATCACCTTACAAACCTTCCAGCCCTCAGGGAGGAAGATGTTCTCAA
GCTCTTACAGAAAGTGCCAGCCAAGGACCCCCAGCAAGAGCCTG
gtgagttgggatggaatgacctggccaggatttcctcttaggacattcttacacatttct
tccagcatgagatttatccagatgtgattgctgagatctttcaagagggtggtgaggagg
tctcctctaaatgagcactgtttgtcctaatcagtttatgggatatagggcattcctcct

Exon  8 +      13749      13794   0   Internal     46   100   Excellent
agccactcagtgctctacactctccatcaccttacaaaccttccagccctcagggaggaa
gatgttctcaagctcttacagaaagtgccagccaaggacccccagcaagagcctggtgag
ttgggatggaatgacctggccaggatttcctcttaggacattcttacacatttcttccag
CATGAGATTTATCCAGATGTGATTGCTGAGATCTTTCAAGAGGGTG
gtgaggaggtctcctctaaatgagcactgtttgtcctaatcagtttatgggatatagggc
attcctcctcttccttggtgaggtgtagggaatcctgtgagtatgatcctgcattctttg
tccttgtggaaccatcacaggaaccactactacagcctcattccagtgaaacagaattag

Exon  9 +      15502      15705   1   Internal    204    87        Good
agttgatactgacttgaggaaaagccctagaagtgacacagatcagaccgacagaaagga
gagagggtaagaacctacaagtggacctctaagtatggcacagcatctctttgcttcacc
catacttgcatcctgaattaattaactctcaagttcagcctgtttctctttgtaattcag
ATGCAGTTGATGCTCCAGTCCCTGAGCACCTGAGCCAGTGTCAGAACCTGACACTCTACC
AGGGCTTCTGTGCCATGAAGTATGCCATCTATGCCCTCTGTGTAAACTCACACCAGCACT
CCCAGTGCCAGGACTGCAAAGACAGCCTCTCTGAGGACCTGGCCTCAGCTACAGAGCCAG
CGAATGACTCTCTCTCCTCCCCAG
gtacagcacttccctccatccgtgagataagctgataacaacacatgccagtgggtgctt
tgtgtgtttaccctcttccaccaagattgggagtggggtgatggccttggttttatttca
cccagggatagtttcatccatctgtcagcctctgaatcaaagggacatggaaaaagaaag

Exon 10 +      19162      19770   1   Internal    609    81        Good
cattaaaagacatcctaagtctcttattcttctcactgtaacctcagttcccttataatt
aaaaaataaataaatgagctaaagttgcgagaatgtttgacgctgggaggtaatgtttct
aatgtttgcattctctgtcttctctttctctggcctcttctcttgtacatgtttttgtag
GTGCTGCAAATCTCTTCTCAACTTACCTGGCCAGGTGTCAACAGTATCTGTGCAGTATTC
CTGACTCTCTGTGCCTGGAGCTTCTGGAAAACATCTTCTCATTGCTTCTCATCACCTCTG
CTGATCTTCACCCAGAGCCTCACTTGCCTGAGGACTATGCTGAGGATGATGACATTGAGG
GGAAGAGCCCCTCAGGTTTGAGGTCCCCATCAGAGAGCCCTCAGCACATAGCACATCCTG
AAAGGAAGTCAGAACGGGGTTCCCTGGGAGTCCCAAAGACCCTTGCTTATACAATGCCAA
GCCATGTGAAGGCAGAGCCAAAAGACAGTTACCCAGGGCCTCATAGGCACAGCTTTTTGG
ACTTAAAACACTTTACTAGTGGTATCAGTGGATTTCTGGCTGATGAATTTGCAATAGGGG
CCTTCCTCAGGCTTCTCCAAGAGCAACTGGATGAGATCAGTAGCCGCAGCCCTCCTGAGA
AGCCAAAGCAAGAAAGTCAGAGCTGCTCAGGAAGCAGAGATGGACTGCAGAGCCGCCTGC
ATCGACTTTCCAAGGTTGTCTCTGAGGCCCAGTGGAGACACAAGGTGGTGACAAGCAACC
ATCGTTCAG
gtgagagaagggtggaactggtgggaccagaaggtggagagggagaaagatcccaggaat
atgggagagagctaggagtacataggagtcaccccataactcagggcatatcgtcaccat
ggcaaccagtgtcagaacactggggtatgctccatgtctcagagcccagtgcaaaccttc

Exon 11 +      24025      24176   1   Internal    152    84        Good
cttctattcaaagatggtagcataggtttgcccttcatttgaggaaaaattaagacctat
ttacaggccttttacagaaggacattgaggagataaaagtttggtgggaggtggcagcaa
tatagcatttccttaattcctcttgcttctctggccccacacattcttgtgtcccaacag
AGGGAAGTCTGAGTGCCATGTCTGGCCGGAATGAGCTGCACAGTAGATTGCACCCCCATC
CTCAAAGTTCACTCATCCCCATGATGTTCTCCCCACCTGAGTCACTGCTGGCATCCTGCA
TCCTTCGCGGGAACTTCGCAGAAGCCCATCAG
gtgaggggaggccataccttttcagcccctgaatgacttagcatcaggtaaggctcggag
catgtacaaccagagccacctgggagcactcaggggtccacatcaagcagaagaagcaga
agcaagagggggtttccatgtgcccaggcccagtcttcagcagggtggattgaaagatag

Exon 12 +      27011      27212   0   Internal    202   100   Excellent
acttttatgaattattttttatagttgacctgctcttctaacattcagtgctcttctgac
cctacaaagcacaaagacatcttagggccacagtctaatggttggcaagatctcctatcc
atggacattccctaaatcagtgggaccaccagggcccacacactccctctcctatgacag
GTGCTGTTCACGTTCAACCTGAAGTCCTCACCCAGTTCAGGGGAACTGATGTTCATGGAG
CGCTACCAGGAAGTGATCCAAGAACTGGCCCAAGTAGAGCACAAGATTGAAAACCAGAAC
TCAGATGCGGGTAGCAGCACCATTCGGAGAACTGGCAGTGGCCGCTCAACTCTACAGGCC
ATTGGCAGCGCTGCAGCAGCAG
gtcaggcttccctgctaacaccataagtggtgaggtggctgggagagggggtaaaagggg
agaaaccactaaaatcctaggctcctcatgagggtgagcagaaattaaatacaggacacc
tgccttgaaaaacagcaaacctgatacgtccagttttccagctgtgcccatcctccttgc

Exon 13 +      28186      28449   1   Internal    264    91   Excellent
tcctttcatgccactgttttgaagctataagagtgggccataatgatagtgctaatatac
atgaaagataccctgtgcagatgaacctcaaacattttgaaagtaactactttacctaat
aaaagttgtagtaagaatccttttaaccctttgctttttattcctctgctgggcggccag
GAATGGTGTTTTACTCTATCTCTGACGTGACTGACAAGCTGCTCAACACCTCTGGAGACC
CCATCCCCATGCTCCAGGAGGACTTTTGGATAAGCACGGCTCTAGTGGAGCCCACTGCTC
CCCTGAGAGAGGTTCTGGAAGACCTCAGTCCCCCTGCCATGGCTGCATTTGACCTAGCTT
GCTCTCAGTGCCAGCTCTGGAAAACCTGCAAGCAGCTTTTGGAGACAGCCGAACGGCGTT
TGAATAGTAGCCTTGAAAGGCGGG
gtgagtgtgctgtgttagctgtatcccttcattctcaaatgagatgggtttctgagagtc
ttgataaattgtccaggaagaaagcagttattggaggaggcagatggtgaatggattatg
aaattttgtcacatacaatctgatggcataaatacagtctgttgagagacaaaatagaca

Exon 14 +      31551      31670   1   Internal    120   100   Excellent
gaatctcaggcatgaaataagccaagtatactggttgtcacccaaaatggcacagcatgt
atttcctccttaatattggagaggataaaatttcacaggtaaatacaggactgagtgtca
atctctgaaaacacttcaattttttttttttgcattccctcttccttcatctatttccag
GTCGACGGATAGACCACGTACTCCTAAATGCTGATGGCATTCGAGGTTTTCCAGTTGTTC
TTCAGCAAATCAGTAAGAGTCTCAATTATCTGCTTATGTCAGCCAGTCAAACCAAATCAG

gtgagttgcttttttctcttttcttctcctggacttggaacattaggtcagcaacagact
ttactttttctttctcatttgctttccatagagagtgtggaagaaaagggaggaggccct
ccacggtgcagcatcactgaactgcttcagatgtgctggcccagcctaagcgaggactgt

Exon 15 +      32507      32671   1   Internal    165    62    Marginal
atcacttgtccaagtgactgacttaggattttatatttgccttgtaagtgtagtgtccag
gccatcagatgccccaggcagtgtatagggggcacagttcacatatccagtcagaaattg
acccaaagctggactcacagactgaagcctgtgtcctttctcctgccatcctcctctcag
AGCCCAGGACTCCTCCACTGTCTTCCCTGGTGGAGCAGGCAGCCCAGAAAGCTCCAGAGG
CAGAGGCCCACCCTGTGCAGATCCAGACTCAGCTCCTCCAGAAGAACCTGGGCAAACAGA
CCCCATCAGGCAGCAGGCAGATGGACTACTTGGGCACCTTCTTCA
gttactgcagcacccttgctgcagttctccttcaaagtttgagctctgagcctggtaggt
agcaagaaagaggcaatagattcatggcagacctgcaagtgttcagggcaaggaagagaa
aagatgcacaattgaaaggctctggatacagcagtagccaagaacactagatttataagg

Exon 16 +      34864      35001   1   Internal    138    66    Marginal
aggtagcccgggagtgtgagcgccttctggaacaattccctctgtttgaggccttcctcc
tggctgcctgggagcccctgcgagggtctttgcagcaggggcagagtctggcagtgaatc
tctgtggttgggccagtctttctaccgttctcctgggcctacattctcccattgccctag
ATGTACTGAGTGAGGCTTTTGAGGAATCCTTGGTGGCCAGAGATTGGTCCCGGGCCCTTC
AGCTCACTGAAGTGTACGGGCGAGATGTGGACGATTTGAGCAGCATAAAGGATGCAGTCC
TGAGCTGTGCTGTGGCAT
gtggtgagcagaatgctatgcctccctttttcactagtggtaatatttggtattcactgg
gtatattatcacatttaatcctcacggtaactctagagagaagccccactataatctcat
gttattaagaggagaccaggtctcagaggggttaggaaacttgcccagggtggtaagtgg

Exon 17 +      36255      36451   1   Internal    197    93   Excellent
ttttccttgtcatataatggttccaagtgtaaaaactagttaagatcacatccatcttaa
ggatcctccaagctcctcttttacgagattgaagaaagccctttctcaagaagtaacctg
gactcttgaactcttctggtcccacgcttgctgcctctgagcatcttttttgtcttatag
ACAAAGAAGGTTGGCAATACCTGTTTCCCGTGAAGGATGCATCTCTGAGAAGTCGGCTGG
CCCTACAGTTTGTGGACAGGTGGCCCCTGGAGTCATGCCTGGAGATTCTGGCCTACTGCA
TTTCAGACACGGCTGTCCAAGAAGGACTAAAGTGTGAGCTACAGAGGAAGCTGGCGGAGC
TGCAGGTGTATCAGAAG
gtatgggccctcgcatcaagagaaagggaacgggcttctcactctatgatcaaccccaac
ctatcttatatgatgggggactttaagaaagagaaaatataggtctgggttttgctttgc
atctggcttcagttcttaggtgaacagcagggaggcctcctagctggttgctgtgttact

Exon 18 +      40049      40225   0   Internal    177    92   Excellent
ctggtcctgtcaaagccatggcatttgggaaactacagaggtggttaaaaaaaaaaagga
gtatagagaaagggttagtccaaaatgagtaaacctaaatattctattctcaaacaaaac
aaagctggtctaagagctcttctgcaggccacaccttcctcctctaccctttgacaatag
CTCCTGCGAAGAATCCCTGACCCCACCATGTGCCTTGAAGTGACAGAGCAATCCCTCGAC
CAGCACACTAGCTTGGCCACTTCTCACTTCTTGGCCAACTACCTCACCACCCACTTCTAT
GGACAACTGACTGCTGTCCGACACCGTGAAATCCAGGCGCTGTATGTGGGATCCAAG
gtaaggatacaccgtgaaatccaggcgctgtatgtgggatccaaggtaaggaggaaaagg
aggtgttgggaaggcatacctgagggagagactgcgagcctagctcttcttcagaacttg
ccttttcaatggctcttttgccaggcacctgccatccctggcctgtgctatatgaaatct

Exon 19 +      41678      41924   0   Internal    247    91   Excellent
attaccatctgcagaatttagtggggagctcagccttcctaaaagactgcgagtctgttt
cagtagctggctatgcaccttttgttctcatgcacccttccccttcccagtgagaatctt
gagttttttctgaaatttgtgtactattttctttactctatggatctaccccacaaacag
ATTCTGCTGACCCTGCCTGAGCAGCACCGGGCCAGCTATTCCCACTTGTCCTCTAACCCC
CTGTTCATGCTGGAGCAGCTGCTTATGAACATGAAGGTGGATTGGGCCACTGTGGCTGTG
CAGACTCTCCAGCAGCTGCTGGTTGGACAGGAGATTGGCTTCACTATGGACGAGGTGGAC
TCACTGCTTTCCAGATACGCAGAGAAAGCCCTGGACTTTCCATACCCTCAGAGGGAGAAA
CGATCAG
gtaactgctagcatcctagaaggggattctacatggaggaagaaatgccatgctgcattc
ttagttttaatttgctccccttttaatattttgggttgatctagagtgaatgaatacact
tcagaagagctatctctttattatataggagagatcttggtcttggaggaagtagaataa

Exon 20 +      42670      42768   1   Internal     99    73        Good
ggcgtttaagaaacatgcgtgctatgggcttagaggtacctcctccattctcttaatacc
tagtagagtcatggaatgacaatcagagaagccaacagagctttgttctaaatgcctagg
gtggtgaatcaagatacttatggtagaaccatattttgtcagcattttccctctctacag
ATTCTGTGATTCACCTCCAAGAAATTGTCCACCAGGCTGCAGATCCCGAGACCCTCCCTA
GATCACCATCAGCAGAGTTCTCTCCTGCTGCTCCTCCTG
gtaagaactggctctgatgattcactaaaatttttcagtttagtcttgccttattctatc
cttcagaattttttttttttttttgcttctttttttcattgccagttacaacattattaa
ttgtttatcttggttcattccagatttatatatatctcaaaagattcaacatacagtcaa

Exon 21 +      45671      45776   2   Internal    106    53    Marginal
tggtaaaattctatcattccctcttcatctataagctggtatattgattaccttttactc
tgacctctggctctgcctcccaggtatctccagtatacattcccctagtctaagggaaag
gagtttcccaccaacccagccctcacaggaatttgtgcccccagcgacaccccctgccag
GCACCAGTGGGTACCGGATGAGACTGAGAGTATCTGCATGGTCTGCTGCAGGGAGCACTT
CACCATGGTAAGCAGCATCGGTCTCCACTGTCACCCTCAGGAGAAG
gtaaaggagaattctagttcatgagcctgagtttacaatcaccgcctgtccccaggagaa
tatcggtattttcagaactgccaaatctaagactttgggttcatttttgacctgaccaga
atgtattttctggattcagacaggtagtagacaccctcaaacagccataaattctaaaat

Exon 22 +      48054      48093   2   Terminal     40    81        Good
atttttaaacattcaatttttgagggcaaggactggtgtgtccttttccaatagagaccc
aagcagttggtgttcttagaaagtataagccactggtagttaataccatgtataaatgga
ttgatggcaatctccccttctctcctccctctttcttctcctcctgatggcattcctcag
TTTAACAGGCGTCATCATTGTCGCCGCTGTGGCCGGCTAG
tgtgcagctcctgctccactaagaaaatggtggttgaaggctgcagagagaaccctgctc
gtgtgtgtgatcagtgctatagttactgcaacaaagagtgagtgtcctacagcagggctg
ttgctattattgaccgctgcacccttccgcaggtccctacactcctaggagtctcattat

Exon 23 +      49236      49267   2   Internal     32   100   Excellent
actgctgagatttgaaatgggcagttagtattgatgggggactctttcattcaacaattc
taccctcaaagagccctccattgtaccagggagacactgtaagttgatgctgtctacgaa
gctcaaaacaaagaagtgactcaggcatttatttaataatttttctttctctgttttcag
TGTACCAGAGGAGCCTTCAGAAAAACCAGAAG
gtaaggccaaatcccgttctctgtgactcttcatttgtgtacttaagttgactctatctt
cagcatatcagctgtgactgatatacttgtccaacttatgcactccatccaacttgtttg
ccaaagcaaattcttggcatttgtatcagcctgtttcctctgaagttcatcatattaacc

Exon 24 +      49950      50080   1   Internal    131    93   Excellent
tggtttgaggtgcttagtggggtgtcctaaagcaaacaaaaggaaccaaggagagagaaa
ggggccctgagatagcaggcaagtgtctacctgcaactcatgccagctcactggactggg
ttagactgaactgccagccagtgaatgacacatgaatggcatttctcttctcagctctag
ACAGCTCCAAGAATGAAAGCCCTCCATACTCGTTTGTGGTGAGAGTCCCCAAAGCAGATG
AGGTGGAATGGATTTTGGATCTCAAAGAGGAGGAAAATGAGCTGGTGCGGAGTGAATTTT
ACTATGAGCAG
gtaatagcaataaaatgcaatggtcacttaagtttctttatgatgtgtagcagtatgaca
agaaatacagaggtaggtgaacacacctggcctttacttgtttatagtgcaataatatgg
gagctaaaccagtaaatccattaaggcagaaaataatgaacatcttgggaattgcagaag

Exon 25 +      51205      51557   0   Internal    353    80        Good
ccaatgcactccagcctgggcaacagagtgagaccctgtttcaaaaaaataaagaagtgg
gtaagaggtggacacagtgcccttcttcccagtaaaatgacataacttaaaagccagagt
tttggcagtgctacttagaacatctgaaatttgtttagttccacttctgctttcttgtag
AATCTGGTTCCTTCTTCCAGGGTCTTTCAGCCTTTTGAAAGGGGAAGGATAATTTCTGCC
ACCCAGCTGCCTTTGGAGAATGCTCTGGCCCCTGGACTCACCGTGTGTTCTCCCTTCTTC
CACCCCGGCCAGGCCCCCAGCGCCTCCTTGTGCATTGCCATCCTGAATCTGCACCGGGAC
AGCATTGCCTGTGGTCACCAGCTGATTGAGCACTGCTGCAGGCTCTCCAAGGGCCTCACC
AACCCAGAGGTGGATGCCGGGCTGCTCACGGACATCATGAAGCAGCTGCTGTTCAGCGCC
AAGATGATGTTCGTCAAAGCCGGCCAGAGCCAAGACTTGGCTCTTTGTGACAG
gtagagggcagtgggtctctattcttttacacaggagcagtttctagccagcttcttttt
ctgaccccactgtgatttttttatctcaccatcctctctgacaagacatgctgaaagatt
tttcatctgtgtaatgttgatgaaacggtgttgccagatctcaagtgttcttccccatcc

Exon 26 +      54965      55112   2   Internal    148   100   Excellent
acccaggaggcggtggttgcagtgagccgagatcggaccactgcactccagcctgggtga
cagaacgagactctgtttcaaaacaaacagaaaaaagaaaatggaataggaaacctttaa
gcggctactcttagtaagacactagggagcctcatggccttgcccttttcctccttgtag
CTACATCAGCAAGGTAGATGTGCTGAATATTTTAGTTGCTGCTGCCTATCGCCACGTGCC
ATCTTTGGATCAGATCTTGCAGCCAGCTGCAGTAACCAGGCTAAGGAACCAGCTTTTGGA
AGCCGAGTACTACCAACTGGGCGTTGAG
gtgagacaaagacaaagacaaagcttacttccaccccactgtagcaagttgcttttgctt
agccttgcaaacaggtgttgccgtctctcagttgtcctgcccatggggtagaatcgggga
catgactagtttgccagcagagaagtaatggcagatagtgggaatgaggtggttggcaac

Exon 27 +      55372      55560   0   Internal    189    98   Excellent
gccgtctctcagttgtcctgcccatggggtagaatcggggacatgactagtttgccagca
gagaagtaatggcagatagtgggaatgaggtggttggcaacttgggaatagaataggtct
ttgggacatttaggcctgaatgtagctaccactcactaaaaggggcaatttttctcccag
GTCTCCACAAAGACTGGGCTTGATACCACCGGGGCGTGGCATGCTTGGGGCATGGCCTGC
CTCAAAGCCGGGAACCTCACTGCTGCACGGGAGAAGTTCAGTCGCTGTCTGAAGCCCCCA
TTTGACCTCAATCAGCTGAATCATGGCTCAAGGCTGGTGCAGGATGTGGTTGAGTACCTA
GAGTCCACA
gtgaggccctttgtatccttggtaagagcaaggcaggaagagtgcctggctcagggaggg
agacccaggaatagcaatgacctgggaaaagaatcagtggaaattcagctaacagtgtca
gtcctggctcagcatcaagcaggttaaaaattttttttttccatcacatatagttagata

Exon 28 +      56200      56418   0   Internal    219    97   Excellent
tatttttttatcatactttaagttctagggtacatgtgcacaacgtgcaggtttgttaca
tatgtatacatgtgccatgttggtgtgcacattgttaaatattctttgcaagcaatattt
tcagtgcctgctgagaactttttgagtttcatttttctctctcgctccctgtgctgtcag
CAAGATGACGATTACTTTGCCACCCTGAGGGAACTGGAAGCTACCCTTCGGACGCAGAGC
CTTTCTCTGGCAGTGATTCCTGAAGGGAAAATCATGAACAACACCTACTACCAGGAATGC
CTCTTCTACCTGCACAACTATAGCACCAACCTGGCCATCATCAGCTTCTACGTGAGGCAC
AGCTGCCTGCGGGAAGCTCTTCTGCACCTTCTCAACAAG
gtgggacatggacacagctcaaaaaggcagtgcctgccttactcctctggcttggaccac
tcagccttaagcgggacaataaccccctgacacttaaccctgtgttgagctatggggcca
tctctagcagagtcaagtcaaaacaggggactctgcacaactgttattcagtgagtgtga

Exon 29 +      59517      59714   0   Terminal    198    67    Marginal
atattcaggcacctgacctagtaccaattatgaatgagtgagtggatagataaatggatg
gcatggaagttcttgaggtgctgcccttctgaggtgttctatctctcctgtagagctaat
gcccctgcttcttaaaatgtgacctacaacttttagattaggtctggttttctctgttag
GAACAACCTGAATCAGGAAAGAAGCCCCTAACCCTCACCCACTATGAATGTTCTCAAAAC
CCAGATCCATTCTGCTTCCAAACAGCTTGTGCCCAGTGTCACTATGCTAGCATGTTATAC
CACTGTGACTTTATAGCCATCCTTGACTCTCCGTTAATTACTCCTAACCTCAAGTCTAAA
TGCCAAGATGATTATTAA
atagccaaggactattctgggcactaaggatacagtagtaaaaaaacagacaaaaggctg
ggcagggtggctcgtttctgtaatcccagcactctgggaggctgaggtgggtggatcact
tgaagtcaggagtttgagaccagcctggccaacatgatgaaaccctgtctctactaaaaa

Exon 30 +      60639      60754   0    Initial    116    43    Marginal
ttgtggacattgtgagggatgagaagggaaacccctgggagactgtgagcagaggagtaa
cgtgatctggcttcagtttcaacagtcacttgggctcatttgtgggcgttagactgacaa
gaggtaagaatggaagctgatagaccagggaggagtctgttgcaataatccagacaaacg
ATGATGGCAGGGATCCAGTGTGGTCCAGGGGAGGTGGTGGGAAGTGGCCAGATTCTGTGT
GCTGTAATGGTGATGGTGGAGCCAATAGAATTTGCTGATGGATTTGATGAAGGAGT
gtgagggaaaagatgactaaggtttttgacctgaacaactaaaagaatggagacacagac
tgagaaagggaagactgtggaaagagcaggtttcaagaaacaagcaggaatgtagttgta
gatgtattcagttagatctccaagtggccatgttcagtagacaattggatataagttgga

Exon 31 +      61639      61836   0   Internal    198    60    Marginal
gagaagtgaagcagtcgctagaatgagattctcaaaggtatctgtgacacataaaagatt
aagaagcactgcattgggaggatgctgaaggttcatcaatagaaggaaattcagagtgga
tcccagacagtgccagaaccaggctcaagacttctgacttctcgccctgccctgctccag
GAGAGTCCTCCAGAAGTTTTTATAGAAGGCATTTTCCAACCAAGCTATAAAAGTGGGAAG
CTACACACTTTGGAGAACTTGCTAGAATCCATTGATCCAACCTTGGAGAGCTGGGGAAAG
TACTTGATTGCTGCCTGCCAACATTTACAGAAGAAGAACTACTACCACATTCTGTATGAG
CTGCAGCAGTTTATGAAG
gtaatggcagccccttcctgccttctacctctgttgctggtgccccaccctgcaggagag
gcagtgcacgatgagggaatgagactgtcattggtccctggccttgctgtttggctgacc
ctagagcaaatccatgttgctctccagtattgttaaataatattaggatttccatcctaa

Exon 32 +      62534      62733   0   Internal    200    89        Good
tgcacttcaggatctcttggaccttgggggtgactggctcaaaatagcagttcagctggt
ggtgggagtgggtgctggaaacaaggtctcataggcagaaatcagatgagaattctcatc
acaccccaccctccaaacccctgatctactttgacctgaacatttattttcctcttctag
GACCAAGTTCGGGCCGCCATGACCTGTATTCGGTTCTTCAGTCACAAAGCAAAGTCATAT
ACAGAACTGGGAGAGAAGCTCTCATGGCTACTTAAGGCCAAGGACCACCTGAAGATCTAC
CTCCAAGAAACATCCCGCAGCTCTGGAAGGAAGAAAACCACATTCTTCAGAAAGAAGATG
ACTGCAGCTGATGTGTCAAG
gtagctggaggttcaggggactattggtgtggggcagaaagggtgggagcagttgtctgt
aggtgatgaagctactcttgtccattccttgaatcctgaaaaaaaatctaaagggaatca
tccctggatgacagtgtgtagtacaagcctagaaagcctacagaggagctggtagtggga

Exon 33 +      63572      63713   2   Internal    142    77        Good
cacgagatcaccatttttttggtcttgtcataactgctcacaaggtacttgaggtctctt
ttcccactatatcatttgttttccctttttcattgccatattattcgacttctcagtctc
ctggcctcagtcacctggggcccctcatgaggctggactgtgcatattctgtcaccacag
GCACATGAACACACTTCAGCTGCAGATGGAAGTGACCAGGTTCTTGCATCGGTGCGAAAG
TGCTGGGACCTCTCAAATCACCACTTTGCCTCTGCCAACCCTGTTTGGAAATAACCACAT
GAAAATGGATGTTGCCTGCAAG
gtacatgcagcgtttcagacctctggcagactattgtcatcttttagaacacttatcata
attgcagttgtctagtgattatttcagttgtttgtttgatggctgcctccccactagaat
atgagccaccaaagactggtgatcaggtccattttgatcattcttatatccctagtgcct

Exon 34 +      64018      64083   0   Terminal     66    58    Marginal
gccaccaaagactggtgatcaggtccattttgatcattcttatatccctagtgcctggca
cttagcagggtctcaacaaatatttgttgaataattgaataaatagaggccttcattctt
ggtcaagagtattctctagtaattgccatgtttttaagcatgattccctttccttttcag
GTCATGCTGGGAGGGAAAAATGTAGAAGATGGTTTTGGAATTGCTTTCCGTGTTCTGCAG
GTATGA
cttggatcattcaaatcatactgaggacaatcagcacctgaccacagttccgggagagat
tattctttaggaaattcttatcccaagaaaagtggatttacatgcacattagggatgaaa
tcaaggatgtgactgttacagaactgggtcaaattcaagactctaggccactttgccaga

Exon 35 +      65258      65482   0   Internal    225   100   Excellent
tacctaactccaaagaggaattgacgcttgctttttgtttggtatatttatgttttctac
tgtgaccacaatcaatatggcttatctacaccaagcatagtgagagcttttaaatgctgc
ctccctccccaccgttaacgtttcctgctcctaagcccatcatgttgtgttctgttctag
GACTTCCAGCTGGATGCTGCCATGACCTACTGCAGAGCTGCCCGCCAGTTGGTGGAGAAA
GAGAAGTACAGTGAGATCCAGCAACTGCTCAAATGTGTCAGTGAGTCAGGCATGGCAGCC
AAAAGTGACGGGGACACCATCCTCCTCAACTGCCTGGAAGCGTTCAAGAGAATTCCGCCC
CAGGTACACTCCCTCCCGTACCTCTTGGCTCCTCCATCAATTTCA
gtgtcttcacatccccatctttattgttctgttttccataatgtgcctgaaactctacaa
gatccttttatcattctgaacccctctgcaataatggcctcaccataattgacccttccc
tgtaaagaaaatttatggagatgacatctatacccagaaggtgaccctcaacatcccatt

Exon 36 +      66688      66732   0   Internal     45    95   Excellent
gaaaagccactacactccagcatgggcaacatagtgagaccccatgtctttgagaaaaaa
aaagtcaggcagacattttcattctgaagtcagaatggctgggctgaggctgggttgggc
cctggctcccagactgcgggactcttctccctctcacagtgctgtttctgttctgcacag
GAGCTGGAGGGCCTGATCCAGGCAATACACAATGATGACAACAAG
gtgagcggaattgtctccaaacgctggtgatgccaatgaattgtgtctcaggcttgccta
gtcacctttatcccttgctccccacaatagttccatacaacccgtatctcagcttctgta
ttatcagaggtggagctgaggcttggataggggtgtagaaaggagggaatagatgaggag

Exon 37 +      69082      69348   0   Terminal    267    55    Marginal
gccttcttttttaaattcttagcttatttgtaataactttttacactataaaataacaca
gtgttatagcatatgtccagaatattgaaagagttgttataataccataaaatacatgaa
tcctgttatgaacgtggcaggtgagacatggtgtctgtctgcccgagctttctgctgcag
CTCTGTATACTTGATTTGTCGGTGATGGATGCCTTTCCGCTGTCTCTTATAACTGACTGC
CAGGTTCGGGCCTACCTGATATGTTGCAAACTGCGTTCTGCCTACTTGATTGCTGTGAAG
CAAGAACACTCACGGGCCACAGCCCTTGTCCAGCAGGTGCAGCAGGCCGCCAAGAGCAGC
GGGGATGCAGTAGTGCAAGACATCTGTGCCCAGTGGCTTCTGACAAGCCACCCCCGGGGT
GCCCATGGCCCAGGCTCCAGGAAGTGA
ccttgggcagtggggccaggaacacgtggcctgagagctgggcaacagcagtgatggcga
tgccctccacctctttcctccagtggagtgggacttctctggctctgccctaggttggaa
agagttggattggaccctacttgccttcccgggcaaggataggacctttcacgcaagtgc

--------------------------------------------------------------------------------