--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7810 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        559        822   0     Single    264    41    Marginal
gcgagtgtcgacgcgtgcggcgcactaaattgtgccgcgctcgcccccgccagaccatgt
cctcctggggaaaaagtttccctagtccccccagcagcgcgccccaccctacgccccgct
ggaaaaaaaacagcaacataaaatcctaggcttgaacattctgtgcgtcccaaatttcta
ATGTCCTCGGCCTGCCCGGTTTGCCGAAGGGAGCCGAGTGTCGAAGAGAAGTCGGGAAAA
GGTAAGTTGTGCAGACACTTGGGGAAGTTTCAAGGAGACCGCCAGCTCAAGATGGAAACC
GCGGCCCGGGCGCTAAGGACGGGCTTCAGCTCCCGCTGGCAAAAAGAGAAAGTCGAGCCC
GCCTTCCTGCCCAACAAAAAACAACAACATGACAACAAGAACCCCGGAGGGAGTGGAATG
AGTGACGTCACAGCCGCGCTCTGA
ggctgacaaaggagggggcgcgcccctcccgctctgcgcccgcgcggccccggagagggg
gcgcctgaagcgccgggtagggaagtcagccgacttgaaacttttcctcttaaagaaaaa
aaaaaaaaagttgtgcgcggctcacagtggggttttttttttccgccttcttttctcgtc

Exon  2 +       1331       1387   0    Initial     57    73        Good
ccggcccaccaaatctgaactttataaattgggctttgcgcgccccagcccggagtcaga
aaggcgaggggcgccgggaactggcgtgtgggactccagacaggagaggctgcgccttcc
ccgcaccgggaccttcgcgacacaccagatcctcgcccctggctcgcgcgaacgcacagg
ATGACCACCACCCTCGTGTCTGCCACCATCTTCGACTTGAGCGAAGTTTTATGCAAG
gtaaaggggggcggagcatttgcttttcaaaaagtctttttcttttgccttaagaaagaa
cccccaaaagtttgggtcttggaaggcaatggggaaagtggtgcagcgagatgattcttt
tctcctccggcatttctcccaagtttgaaggaatttggccccgtccttcccaccctttga

Exon  3 +       3777       4570   0   Internal    794    95   Excellent
caaaataaacccaggtgaatggcctatgggagggagagagggaagggagcttgctagagc
cgaggtagagatgagttctttgagaaagagcgggcgtttgtgattgtgtagggggctgcc
catagtggacatcctggtggatgtcctctgtccttaccatcctttctcttctctctccag
GGTAACAAGATGCTCAACTATAGTGCTCCCAGTGCAGGGGGTTGCCTGCTGGACAGAAAG
GCAGTGGGCACCCCTGCTGGTGGGGGCTTCCCTCGGAGGCACTCAGTCACCCTGCCCAGC
TCCAAGTTCCACCAGAACCAGCTCCTCAGCAGCCTCAAGGGTGAGCCAGCCCCCGCTCTG
AGCTCGCGAGACAGCCGCTTCCGAGACCGCTCCTTCTCGGAAGGGGGCGAGCGGCTGCTG
CCCACCCAGAAGCAGCCCGGGGGCGGCCAGGTCAACTCCAGCCGCTACAAGACGGAGCTG
TGCCGCCCCTTTGAGGAAAACGGTGCCTGTAAGTACGGGGACAAGTGCCAGTTCGCACAC
GGCATCCACGAGCTCCGCAGCCTGACCCGCCACCCCAAGTACAAGACGGAGCTGTGCCGC
ACCTTCCACACCATCGGCTTTTGCCCCTACGGGCCCCGCTGCCACTTCATCCACAACGCT
GAAGAGCGCCGTGCCCTGGCCGGGGCCCGGGACCTCTCCGCTGACCGTCCCCGCCTCCAG
CATAGCTTTAGCTTTGCTGGGTTTCCCAGTGCCGCTGCCACCGCCGCTGCCACCGGGCTG
CTGGACAGCCCCACGTCCATCACCCCACCCCCTATTCTGAGCGCCGATGACCTCCTGGGC
TCACCTACCCTGCCCGATGGCACCAATAACCCTTTTGCCTTCTCCAGCCAGGAGCTGGCA
AGCCTCTTTGCCCCTAGCATGGGGCTGCCCGGGGGTGGCTCCCCGACCACCTTCCTCTTC
CGGCCCATGTCCGA
gtcccctcacatgtttgactctccccccagccctcaggattctctctcggaccaggaggg
ctacctgagcagctccagcagcagccacagtggctcagactccccgaccttggacaactc
aagacgcctgcccatcttcagcagactttccatctcagatgactaagccagggtagggag

Exon  4 +       4626       4736   0   Terminal    111    48    Marginal
ctgcccgatggcaccaataacccttttgccttctccagccaggagctggcaagcctcttt
gcccctagcatggggctgcccgggggtggctccccgaccaccttcctcttccggcccatg
tccgagtcccctcacatgtttgactctccccccagccctcaggattctctctcggaccag
GAGGGCTACCTGAGCAGCTCCAGCAGCAGCCACAGTGGCTCAGACTCCCCGACCTTGGAC
AACTCAAGACGCCTGCCCATCTTCAGCAGACTTTCCATCTCAGATGACTAA
gccagggtagggagggacctcctgcctactccagcccctaccctgcacccacatcccata
ccctcttctccctacccatcccattccccacaggccctacattaacaaggttaagctcaa
cccctttcccccagcacctcagaatgtgccctccctctccccctcataaccccacctaac

Exon  5 +       5460       5506   2   Internal     47    83        Good
ctcctcccctcttcccggtggcacctctccacctgtacccgcccccccaccccccccacc
cctgccccttggaagagttgttgccagaccagggttttgggggaaacctgtcttgacatt
caaaacctttttcttcccgatctgaacccctgttgactaatcttgcctgggtttgtgtag
GTCTGCAGGAAGGAAGGCTGAAAAAGCGGACGAAGATTTTGACTTAA
gtgggactttgtgatttaattttttcttttttttaagtggggaggaaggggaagctagat
ggactaggagagacttgattttggtgctaaagttccccagttcatatgtgacatcttttt
aaaaaaaataacaacaaaaaaaaaatgagagaaaagctaaaaaaaaaaaagtaaggggtg

Exon  6 +       6236       6409   2   Internal    174    50    Marginal
tttccacagttttaatatattattcttcaacgacattttttgtaactttacacttttttg
gttattttattttaaaaaaatgaaaaattaatttaaaaaaatgcaaaaaactgttggatt
atttattttagaaattcccccctttgtgttggactgcaaattgagtttctttctctttag
GCCTTTCACAACTAGGACTGAGAATGTATGTAAAAGTTCTGTGACAGTACAGAAGGAAAA
CAACTTTTTATGTATAGCTTCTAAAAGGGGAAAAAAAAAAAAAGAGAAACCCTTTGACTT
CCACGTGCCCATCTCAAGACATTCCACTCACAGATTTGAGGTTCTGGATTCCAG
gtctggagttttccaatgttaatgtaaacagaactggcacacacacattaagatgaatgt
aattattattcctcttgctggtcactaccgtcgctttctatttctctttctttgtgtgaa
tttatttaaaagaaaaaaaaactttttgtaacgactatttgcagtttaaaaatcaataaa

--------------------------------------------------------------------------------