--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8614 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1805       1888   0    Initial     84    49    Marginal
ccaggggtggaaggcgtgacacactacaaggccggcgaccctgttattctgtatgtcaac
aaagtgggaccctaccataaccctcaggaaacttaccactactatcagcttccagtctgc
tgccctgagaagatacgtcacaaaagccttagcctgggtgaagtgctggatggggaccga
ATGGCTGAGTCTTTGTATGAGATCCGCTTTCGGGAAAACGTGGAGAAGAGAATTCTGTGC
CACATGCAGCTCAGTTCTGCACAG
gtcagcctctccacattggctatcacgtagccctccttcccagagactaacagtgcctta
catttatggttcagggtacctttatggaaattgtctgatttgattctaactacaatacaa
cccagtgtggcaggcaggttaggtgatgctattctaattcagttgactaagatacatact

Exon  2 +       3294       3915   0   Internal    622    96   Excellent
agttgcagtaagccgagatcgcaccactgcactccagcctgggtgacagagcaagactcc
atctcgaaaaaaaagaattatccaccccaaaatatcagtagtgctgaaggtgagaaactt
tgctgtaactctgcgcctggggagatcttgtgtgaccaactcctgacttgctctttatag
GTGGAGCAGCTGCGCCAGGCCATTGAAGAACTGTACTACTTTGAATTTGTGGTAGATGAC
TTGCCAATCCGGGGCTTTGTGGGCTACATGGAGGAGAGTGGTTTCCTGCCACACAGCCAC
AAGATAGGACTCTGGACCCATTTGGACTTCCACCTAGAATTCCATGGAGACCGAATTATA
TTTGCCAATGTTTCAGTGCGGGACGTCAAGCCCCACAGCTTGGATGGGTTACGACCTGAC
GAGTTCCTAGGCCTTACCCACACTTATAGCGTGCGCTGGTCTGAGACTTCAGTGGAGCGT
CGGAGTGACAGGCGCCGTGGTGACGATGGTGGTTTCTTTCCTCGAACACTGGAAATCCAT
TGGTTGTCCATCATCAACTCCATGGTGCTTGTGTTTTTACTGGTGGGTTTTGTGGCTGTC
ATTCTAATGCGTGTGCTTCGGAATGACCTGGCTCGGTACAACTTAGATGAGGAGACCACC
TCTGCAGGTTCTGGTGATGACTTTGACCAGGGTGACAATGGCTGGAAAATTATCCATACA
GATGTCTTCCGCTTCCCCCCATACCGTGGTCTGCTCTGTGCTGTGCTTGGCGTGGGTGCC
CAGTTCCTGGCCCTTGGCACTG
gtgaggtgataaaaatgaattggggatttatctcatgggatagaactaggtagggagttt
gttcagaaaaggtctgtggatcttctcttctatccagaggggcagacctaagggataggg
tggctctagcaagaatgcacgtattctattgtagattttctggatagcaaaactggggga

Exon  3 +       4207       4413   1   Internal    207   100   Excellent
gggatagggtggctctagcaagaatgcacgtattctattgtagattttctggatagcaaa
actgggggagattgttttgctggaggccctgggtctgggagaaggggggctgattcctct
gaaattgctagaagagacacaggtgaggcctaacttgggctttccgctaccgtcctgcag
GCATTATTGTCATGGCACTGCTGGGCATGTTCAATGTGCACCGTCATGGGGCCATTAACT
CAGCAGCCATCTTGTTGTATGCCCTGACCTGCTGCATCTCTGGCTACGTGTCCAGCCACT
TCTACCGGCAGATTGGAGGCGAGCGTTGGGTGTGGAACATCATTCTCACCACCAGTCTCT
TCTCTGGTGAGGACTTTCCTTTCCCTG
gtgggcctttctggacttaggaatgaagaacacattgtggctggtcacagtggctcacac
ctgtaatcctagcactttgggagaccgaggccggaggatcacttgagcccaaaagtttga
gacaagcctagacaacatagtgagaccctctctctataacaaaaaattagccgggcatgg

Exon  4 +       5910       6183   1   Internal    274    69    Marginal
gggacctgaaagggtggaggtgaaggcagtcgactctgcagggacatccaggagcatgag
tctgccgttagagtggcaggctgcttcagccccctccccttttggtcctggatgtaagtg
ggtgcccttagagatgtagctcctagtgttgaccctccctccgggggcccatccctgcag
TGCCTTTCTTCCTGACGTGGAGTGTGGTGAACTCAGTGCATTGGGCCAATGGTTCGACAC
AGGCTCTGCCAGCCACAACCATCCTGCTGCTTCTGACGGTTTGGCTGCTGGTGGGCTTTC
CCCTCACTGTCATTGGAGGCATCTTTGGGAAGAACAACGCCAGCCCCTTTGATGCACCCT
GTCGCACCAAGAACATCGCCCGGGAGATTCCACCCCAGCCCTGGTACAAGTCTACTGTCA
TCCACATGACTGTTGGAGGCTTCCTGCCTTTCAG
gtatcctccctttattccatggctattactgtcaggttcctgacctcaatttttcctgtc
cctactcatccagtaccctaacccaacccgttgatccctggttcagtggtaccattcaga
gatcattaaatggttcctcctatccccaagcaggactgagcttgaatgatatgagagtgt

Exon  5 +       6755       7108   2   Internal    354    84        Good
cggctaatcataggcaaaaaatccccatgaagccaggagatctggggcagagagtggagt
gaactcacttttcacaatgacccagcaacatgggagagggtgggggctggatttcagccc
agccactgtgctgatggtgcacagccctttaatgctgtgtatcatctcttttcttcacag
TGCCATCTCTGTGGAGCTGTACTACATCTTTGCCACAGTATGGGGTCGGGAGCAGTACAC
TTTGTACGGCATCCTCTTCTTTGTCTTCGCCATCCTGCTGAGTGTGGGGGCTTGCATCTC
CATTGCACTCACCTACTTCCAGTTGTCTGGGGAGGATTACCGCTGGTGGTGGCGATCTGT
GCTGAGTGTTGGCTCCACCGGCCTCTTCATCTTCCTCTACTCAGTTTTCTATTATGCCCG
GCGCTCCAACATGTCTGGGGCAGTACAGACAGTAGAGTTCTTCGGCTACTCCTTACTCAC
TGGTTATGTCTTCTTCCTCATGCTGGGCACCATCTCCTTTTTTTCTTCCCTAAA
gttcatccggtatatctatgttaacctcaagatggactgagttctgtatggcagaactat
tgctgttctctccctttcttcatgccctgttgaactctcctaccagcttctcttctgatt
gactgaattgtgtgatggcattgttgccttcccttttgccctttgggcattccttcccca

Exon  6 +       7754       7844   2   Internal     91    99   Excellent
gtcgggtttccgcgattcagccggtgctcagcctaacggaagtggaggagccggacctct
ttgtgggaagcgaattgaatcaccttggcaacccgcggggcgtgcagcaacgccctttcc
tccggaagtgggtgtcagaacctccacgtgctgtccctccccctccccttttcggcccag
TAGCGGCGGCTCAGTTGCTGCCATGGAGTCAGCCGGGCTAGAGCAGCTCCTACGGGAGCT
GCTGCTACCGGACACCGAGCGCATCCGTCGG
gtacggagcaggcgtaaccgggccagggcgagcgggaggttgcgggaaaggcccaactct
cacccctagcttccccccaggccacggaacagctccagatcgttcttcgggcccccgccg
ctttgccggctctctgcgacctgctagcctcggcggccgacccccaggtgagacccctga

Exon  7 +       7925       8011   0   Internal     87   100   Excellent
tcggcccagtagcggcggctcagttgctgccatggagtcagccgggctagagcagctcct
acgggagctgctgctaccggacaccgagcgcatccgtcgggtacggagcaggcgtaaccg
ggccagggcgagcgggaggttgcgggaaaggcccaactctcacccctagcttccccccag
GCCACGGAACAGCTCCAGATCGTTCTTCGGGCCCCCGCCGCTTTGCCGGCTCTCTGCGAC
CTGCTAGCCTCGGCGGCCGACCCCCAG
gtgagacccctgactctcccctccgagcttcccactgtacgccaccggtcaagccccagt
attcgcccactgcggtccgctcagcaccttcctgcccggacccccacgtgcttgcttcct
cgtcctagatccgccagtttgcggccgtgctgacccgcagacgactgaacacccgctggc

Exon  8 +       8140       8219   0   Internal     80   100   Excellent
cgccgctttgccggctctctgcgacctgctagcctcggcggccgacccccaggtgagacc
cctgactctcccctccgagcttcccactgtacgccaccggtcaagccccagtattcgccc
actgcggtccgctcagcaccttcctgcccggacccccacgtgcttgcttcctcgtcctag
ATCCGCCAGTTTGCGGCCGTGCTGACCCGCAGACGACTGAACACCCGCTGGCGACGGCTG
GCGGCGGAGCAACGGGAGAG
gtgggctgggcctggggtggggcggggccaggcggagacttttcttgggcaggctgggta
ccaaacacctgccacctgtgttccagcctcaagtccctgatcctgacggccctgcagaga
gaaacagagtaagtacctacccacttctctcgggatcttgacgactttgtctaggtttct

--------------------------------------------------------------------------------