--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (48935 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        118        178   0   Internal     61    89        Good
ttccaagagatagtttattttttcccctcttttcccctccccactacactttccacttag
ccctttttgaactgcaaaataacctctcaactcccctcaccagaccattctctacagAGCAAATTCATCTACGAGATCCAAGACGCAACTCCCACCGCCAGGCGGTCGCCTCAGAAG
G
gtaagcagaaagcatgcccacttggccacttttacaacttatttctgctcagaaatgcac
caactcaactacccggtagataaggcaccagctagcagagacctcttgctcatttcctct
tgtaccttataaaatgcccgcttttttgctccaaagacgaagcgggctggcttcagaaat

Exon  2 +      10630      10760   1   Terminal    131    63    Marginal
tattatataataaaatatattttttaaatttaaggcaaaaatgttttaaaatacacactg
ccagtaactacttgcagaaggaaaagtatattggaaaacctcacagaagtttttaaaatt
tttaaatttaaaacaaccagttaacatggaaagttagatttatatttaagaatttactag
GCAGCCATAAAAAGAATGAAATCATGTCCTTTGCAGCAACATGGATGGAGCAGGAGGCCA
TTATCCTAAGAGAACTAATTCAGAAACAGAAAATCAAGTATCTCATGTTCTCACTTATAA
GTGAGAGCTAA
acataggtacccatggacataaagacgaaagtagtagacacagaccattccaaaatggaa
gagtttgggagaagactgaggattgaaaaagtacctcttgggttcaaggttcaatatttg
ggtcatgtgtgtataagtccagtccccaccattacacagtataccagtgtaacaaacata

Exon  3 +      14886      14963   0    Initial     78    92   Excellent
gactgtatttaagcacaggttgaggctatggaaggtgatcttacagtatctaaacactag
agtaatttgaacttaaatactctttagaactcttcagtcatgggaagtgaaattgattat
tctcacttaattttttttctgctgtagagttcttcgtaagtacatcttaaagctgtcaag
ATGGTTCTAGCAGACCTTGGAAGAAAAATAACATCAGCATTACGCTCGTTGAGCAATGCC
ACCATTATCAATGAAGAG
gtatgtaaaatattgtatgaaatatatatgattgtatattgtcactagcattgggaagat
ggcttattcataatccctgtatttatatgtattttgatgtagacttaatacttgtagata
aaagcctaaaagtggatacagtaagtagtgttttattgagaaattaactacaacttcaaa

Exon  4 +      17734      17825   0   Internal     92    90   Excellent
ggtctcttattttgacaaaatgactaaacatttaataaaattatctctccaagaactaac
tgaaaaacccagtagtgtggtattactaagctgtggttatgtaagtgatcaacaattgtt
tttatggaactgaaatgaaacattgggtgctttaaatttcatttatttctttattttcag
GTATTGAATGCTATGCTAAAAGAAGTCTGTACCGCTTTGTTGGAAGCAGATGTTAATATT
AAACTAGTGAAGCAACTAAGAGAAAATGTTAA
gtaagttaaatcaatcaggtaaaacacaggcacagtttagtttagtttactggaaagagg
tgctaactggaagtgtttgctgtatcaggaatcatttctgctctgcaccactggaaaagt
gctgtgttggagctcatatgttgggcgagagcatgtgtagtacgtttccataatgatggt

Exon  5 +      26950      27007   1   Internal     58   100   Excellent
tgatattatatttttaaatcttttctcacccagctagcatattattaccagaggaaaggt
tggaagacctgtttaatatgtgcagacacattcagagcaggtaatgtcttgaaatttgaa
aattgttttatataatttttattttcaagtttgaggattcatgaactctttatcttccag
GGGCTTTTGACCAACTAAAACAGAATGCTACCAAAGCAAGAATTCCATTTTATGGAAG
gtaggttactgttttttattttaacacttatatccctcttcttgtctgtcagcttttttt
tttttttttttttgagacggagtctccctctgtcacccaggctggggtgcaatggtgcga
tcttggctcactgcaaccaccacctcctgggttcaagtgattctcctgtctcagcttcct

Exon  6 +      29685      29835   2   Internal    151    99   Excellent
atgcttcatgcttttttagaagtagattctgtatttaatactttatagattttcctcttc
taaattgaaattggggtcattttggctttttcaaaatagattataggtaaattaactttc
cgaattagtagtatttggaagttttgtcgttttgttaaatcatttgtccatgttatatag
CTATACAGAAATGGATCCTGTCATCATTGCTTCTGAAGGAGTAGAGAAATTTAAAAATGA
AAATTTTGAAATTATTATTGTTGATACAAGTGGCCGCCACAAACAAGAAGACTCTTTGTT
TGAAGAAATGCTTCAAGTTGCTAATGCTATA
gtaagtagctttcaatgtaacactattattaggactttggttaatttaattataaaacca
ggttgagtatatgaccaatataaattattctttgcctgtgaggcagatccccagtaattt
atttttgttttgggcacctatatctatgtggtagggacttaatttcattatttttgttct

Exon  7 +      31522      31670   0   Internal    149   100   Excellent
ccaggctggtcttgaactatctcaggtgatccacctggctcggcctcccaaagtgctggg
attacaggcatgagccactgcacctggctctaaatattgttttatagcttctaatgatga
catttgcttaggatcaataaaaatcttttctaaagtatcttttctatttaaactttctag
CAACCTGATAACATTGTTTATGTGATGGATGCCTCCATTGGGCAGGCTTGTGAAGCCCAG
GCTAAGGCTTTTAAAGATAAAGTAGATGTAGCCTCAGTAATAGTGACAAAACTTGATGGC
CATGCAAAAGGAGGTGGTGCACTCAGTGC
gtaagtatcattgatactgttgtcctctgtcttgggattatatggggaaggatatgtgtt
tatagctttcatattgatcatttaaaatatgtttcaatagtgagcctaatatggtttata
aagaaagtttaaatagaaacaattttggagcctgtctgatataggtctattataacttgt

Exon  8 +      31978      32078   2   Internal    101    58    Marginal
tttaaatagaaacaattttggagcctgtctgatataggtctattataacttgtgaaatga
aacttgagttttgtacctttgtctaattagctttggaggcggattcacttcgaatttcag
atctgctggaaatttgtggggttcttttgaggttattttatattttctttttttttccag
AGTCGCTGCCACAAAAAGTCCGATTATTTTCATTGGTACAGGGGAACATATAGATGACTT
TGAACCTTTCAAAACACAGCCTTTTATTAGCAAACTTCTTG
gtatgtacagtggtggggatatagaaaaatctccaagaaatacgatgtatctttaggaca
aaataggattttaattctgtcctcactaatttaagcacatcatttctttctgtgacttag
tttccttacctgtaaaatagagataatggttatctgccctctgtggtgaaagtggtaaaa

Exon  9 +      32920      33006   1   Internal     87    99   Excellent
gccaccgctcctggccatgccacttaactttcttagctttggttttctcatttgtgtagt
gtagtaagaatacctaacctattataacctcacaaggttattatgtatgtgaatgtgttt
tgtataatgtgaagcagggtatagtattagttgttaatttttcttttttgtatcttatag
GTATGGGCGACATTGAAGGACTGATAGATAAAGTCAACGAGTTGAAGTTGGATGACAATG
AAGCACTTATAGAGAAGTTGAAACATG
gtatatgagtgacaaaaaagcacttcatctcagatttcttccattgattttttttataaa
gttactattaagttatttgaaatgtaatatctgttagagtcagatcttccactgcttatt
attttagatgatttatatgcaaatcatttaaaatctcaggtacctgagcagttacagaat

Exon 10 +      36868      36941   1   Internal     74    83        Good
atgtattctccccagcattcatcctgtcatcttgcacatggtaactgcttggtgaatatt
tattgatgtatattttataaatatgcttcaagatgaattcatgattaaggaataaattag
ttttgttgaatggaaatgtacatactttaatatatccgaattatttacattgtatttcag
GTCAGTTTACGTTGCGAGACATGTATGAGCAATTTCAAAATATCATGAAAATGGGCCCCT
TCAGTCAGATCTTG
gttagttatccttaaaactttataccttcttttgttttcattaaattttctaaaatagat
acacttgctttaattatttttacattcgggtaaaaatatatctaagacttagtgtcaata
ttaaacctaatagttaaatgtggacattttgaaccattaatcttaagctactattgactt

Exon 11 +      37142      37250   0   Internal    109    81        Good
tataccttcttttgttttcattaaattttctaaaatagatacacttgctttaattatttt
tacattcgggtaaaaatatatctaagacttagtgtcaatattaaacctaatagttaaatg
tggacattttgaaccattaatcttaagctactattgactttatgtttaaatctgttgtag
GGGATGATCCCTGGTTTTGGGACAGATTTTATGAGCAAAGGAAATGAACAGGAGTCAATG
GCAAGGCTAAAGAAATTAATGACAATAATGGATAGTATGAATGATCAAG
gtaagatggcagattattttcctcaggcaaaaatgttctgagtatcagtaagatgagagt
ttcactgtattcttgtggacaagatggggagaaatttagcctgaaagattatttttaggt
agatttgtaatagcttgaaagctcttactcaaagggttatgattattggattgccttcat

Exon 12 +      46264      46388   1   Terminal    125    92   Excellent
gtaattgagaaaaagattagaagggaatatgtagaaatagaaagaattatgttagagtga
taggattatgtaattttttcttagtattttctcagttcatcaaactttctattataccct
gattatactgattatattacctcctacgctgactcaaaatctttttttttttcccctcag
GTGGCGACATGTCTAAGAATGTGAGCCAGTCACAGATGGCAAAATTGAACCAACAAATGG
CCAAAATGATGGATCCTAGGGTTCTTCATCACATGGGTAAATACCAAGTTGTTGGCAGTT
GCTAA
tgcagtttaatttataagggttgagttttaatgataagccttttattgtaatattatgaa
aatatgttcaaaaggtgtgtgatttcagggaaatggtcatctgaatcctaagttgaattc
aattgtaatagggcttattagctgaggtcttattcactcctctgctgccatctgtgtgat

--------------------------------------------------------------------------------