--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (71119 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1180       1258   0    Initial     79    66    Marginal
cttcaggctctcccgacttcggtgccttgaccttgggcagaaggccctgttaaccttcct
cgctcacggactcgagcgaccagcgccggggacggggcgggccgtccttaggccccgccc
cttcgcctccgccccgccccgccccgctcctggccgccggctccctccggcagcagggag
ATGCGCGCCTGCGCCGGCCCTCGCCTCGGAGCAGCCATGATGGTGGGTGTTCTCCGCGGC
GCCGAGTCCCGGGAGCGCG
gtgggggcagcgggcgcggggcgggcgcggggaccgcgccagcctgtcactaatgtctcc
ctttgtgtctcccccatctcatccttttccccggcgcgccgtgcccgccgaccccacagg
aaggcctggacgacggcccggacttcctctcagaagaggaccgcggagtaagttctgcct

Exon  2 +       1378       1425   0   Internal     48    85        Good
cctcgcctcggagcagccatgatggtgggtgttctccgcggcgccgagtcccgggagcgc
ggtgggggcagcgggcgcggggcgggcgcggggaccgcgccagcctgtcactaatgtctc
cctttgtgtctcccccatctcatccttttccccggcgcgccgtgcccgccgaccccacag
GAAGGCCTGGACGACGGCCCGGACTTCCTCTCAGAAGAGGACCGCGGA
gtaagttctgccttcctttcgctcgcgggaccctggaccctccttccccatcctgggtcc
ccgggtgtggtacggggatgggtccccagccgcgcggcactccctccccgtagtcctcct
ttcggtttcctcgctgcaccgcgccccaccctcccgcagcccttcctccctaggggccgc

Exon  3 +      21590      21694   0   Internal    105   100   Excellent
tagcgttgcccaaagcagctgcttcaaaatgtatatagtatgtatgttaaatggacatga
gtacctctttagacttaataatcttttgttatttttgttttgtttttgcattgtcttaag
agaaaaaatgaaattatataaaacatgattttcatgaagatactggttttctttttctag
CTTAAAGCAATAAATGTAGATCTTCAAAGTGATGCTGCTCTGCAGGTGGACATTTCTGAT
GCTCTTAGTGAGCGGGATAAAGTAAAATTCACTGTTCACACAAAG
gtaaatgtgattttgtactttctattattttagccatttattatactacatatgtgatat
gttgaccagacttgggttttaaacataattggaaagaaactattttaacaaaaatagatg
taggaaaatgtacttttttttttttttttttttttttgagacggagtcttgctctgtcgc

Exon  4 +      25615      25736   0   Internal    122    92   Excellent
ctggccaaaacttaatttctacaactagtcaagttctccaatctgaatttgggtgttcct
ggtgttcagctcattctggatccccttagctttcccagacacagtcttctatggtggcag
tagtacaatgcttcaagaaatgaaaatttccttaaaattagtcatttggtcctgttacag
ATTCCACCAGCACCACCAAGACCTGATTTTGATGCTTCAAGGGAAAAACTACAGAAGCTT
GGTGAAGGAGAAGGGTCAATGACGAAGGAAGAATTCACAAAGATGAAACAGGAACTGGAA
GC
gtaagtgatttttttatttttttgttttttttttttggttgttgttgcctttgttaattg
tgcttgctttaatgccttttttggtgttttctgatatcccatcattaaaccctttctgga
agatgcaggtttaagtcatacaaccagtattaatgatcatgatcagagcctacaggaaaa

Exon  5 +      27861      27984   2   Internal    124   100   Excellent
aagctgggttttatgtatttcattaacagttcaactaaaaaccttgtttacatgaattat
atctttgtatctctgatttgcattcggaataatccaaagagtattttctgaaaaaaattg
ttgcaggtgactttttagttgatggagttttttacctttaattttgtatattgtttctag
TGAATATTTGGCAATATTCAAGAAGACAGTTGCGATGCATGAAGTGTTCCTGTGTCGTGT
GGCAGCACATCCTATTTTGAGAAGAGATTTAAATTTCCATGTCTTCTTGGAATATAATCA
AGAT
gtgagtatcacattgattggtggtcaagttttctttttcttcttcttcttcttttttttt
ttgagacggaatctcgctctgtcttccaggctggagtacagtggcatagtggcatgatct
tggctcactgcaagctccgcctcccgggttcatgccattctcctgcctcagcctccctag

Exon  6 +      30137      30193   0    Initial     57    74        Good
cgcatgcctgtagtcccagctactcgggagactgaggcaagagaatcgcttgaccccggg
aggcggaggttgcagtgagccaaggttgcgccactgcattccagcctgggtgacaaagcg
agactccgtctcaaaaaaaaaaaaaaaaaaaaaaaagaaatagggttatcacattgacta
ATGTTTCTTAAATTTGAGTTTGGAGTCTTCCGAAGCCTTGTGGAGAATTCCAAGGAG
gtgattgagctaaagaattccagattcgggtaaattattgactctggatctgtttaactg
accattggtgctgatcactccttattttttccttccctgcctaaaaactctctttttttt
tttttgaggcagagtctctgtcgcccaggctggagtgcaatggcactgtatcgactcagt

Exon  7 +      32218      32268   1   Internal     51    68    Marginal
tagactcatctaatgtgaggttacagttacagtctctgtgtaaggaaatgatgtgggcaa
ttggatataacatataaagttaaggaaagagcttatgggtagtattctagtctgtttggc
tgctataacaaaataccttagactgggtaatttataaacaacagaatttatcatttacag
TTCTGGAGAATGGGAAGCCCAAGATCAGGGTGCTAGCAGATTGCGTGTCTG
gtgagggccctctgcttcataggtggccctttttgttgtgtcctcacatagcagaaggaa
ggggcaagagggtaacattccctcagcctcttttataaggactaatcccatttatgaagg
ctctaccctcatgacctaatcacttctcaaaagccccacctatttttaagagacagagtc

Exon  8 +      33687      33782   0   Internal     96    57    Marginal
ttaccaaactccttttttatgccctaaaatttgaaaatcattgatgtgcatgatgaaatt
tccactttattaagattaaaaactaggatccttttgagattgccatttaaatatcaaaga
ataaaggaggcactgctttccatttgtaaccttaaaaatgttaaattacctttctttcag
TTGAGTGTGCGAGGAAAAAATAAAAAAGAGAAACTTGAAGACTTCTTTAAAAACATGGTT
AAATCAGCAGATGGAGTAATCGTTTCAGGAGTAAAG
gtaagattttatttgattaactgtggtattagttgagacttcttttaaaagggagataga
ttgagatttcaaatgtgcagaattagagtaaaagacatttggacggttagaatcttcagt
cctaggaacaggaggaatcctcctgacctagattcctctctttagagcgttcccttctgc

Exon  9 +      38182      38287   0   Internal    106   100   Excellent
cttgatagatagaaatgcatgtctattaaagtcttgttggtgaaattagtataataacat
ctgactgaggataggtatgctattttactgatgatcttttatatttataatgatagttat
ttacatataaaactaaagcaaataagtgaaaaaagtttatattttcttttgatcttatag
GATGTAGATGATTTCTTTGAGCACGAACGAACATTTCTTTTGGAGTATCATAACCGAGTT
AAGGATGCATCTGCTAAATCTGATAGAATGACAAGATCCCACAAAA
gtaagatttttctgtggctaaagcttatatcttttaatggaataattataaagttcatat
tatagtttgaaaaagtcttaatatagagcagtagttctcaaactggtctgttggagccta
ggctccatggcccttttatagtgagcctgtgaggtcaaaactattttcagctgggcacag

Exon 10 +      55490      55576   0   Internal     87    90   Excellent
gaacccaggaggcggagcttgcagtgagccaagatagcgccactgcactccagcctgggt
gacagagcaagactccgtctcaaaaaaaaaaacaaaaaaacaacaacaacaaaaagaagg
aaaccactgagaggagaatgtagttgttgattaaatattcaattttttccttcttttcag
AAAATAGAAGCACGAGTGTCTGCTGATGAAGACCTCAAACTTTCTGATCTTTTAAAATAT
TACTTAAGAGAATCTCAAGCTGCTAAG
gtaattttaatctttttttaaatgagccattttacaaacagccatttcttgagtttgtta
gacttcagattgttaatgatgatttatctcctttatatgattttaaattatattttcaaa
tatgaattctatttctccttttagaaattgtatatatgtgtataattgtacatatttcat

Exon 11 +      62203      62643   0     Single    441    84        Good
gggtgatgaaagtgttctaaaatcgattatggtgatcctcagttctgtgagcttgctaaa
aaccattgaattacatattttaaattgtgagttatgtggtacatggactatcaagctgtt
acttaaaaaaacggactgagccctttcccctggctggcagtgcacaggccgggccgcatg
ATGCCTGGAGTTACTGTAAAAGATGTGAACCAGCAGGAGTTCATCAGAGCTCTGGCAGCC
TTCCTCAGAAAGTCTGGGAAGCTGAAAGTCCCCGAATGGGTGGACACCGTCAAGCTGCTG
GCCAAGCACAAAGAGCTTGCTCCCTACGATGAGAACTGGTTGTACACGCGAGCTGCTTCC
ACAGCGTGGCACCTGTACCTCTGGGGTGGCGCTGGGGTTGGCTCCATGACCAAGATCTAT
GGGGGATGTCAGAGAAGTGGCGGCATGCCTGGCCACTTTAGCCGAGGCTCCAAGAATGTG
GCCCACCGGGTCCTCCAAGCCCTGGAGGGGCTAAAAATGGTGGAAAAGGACCAAGATGGG
GGCCGCAAACTGACACGTCAGGGACAGAGAGATCTGGACAGAATCGCTGGACAGGTGGCA
GTTGCCAACAAGAAGCATTAG
aacaaaccatgctgggttaataaattgcctcattcgttaaaaaaaaaaaaaaaacaggct
gagtgcagtggctcacgcttgtaatccactttagcaggctgaaatagggggatcactttg
aggccaggagtttgagacctgcctgggcaacatagtgaggccccgtctctacaaaaatct

--------------------------------------------------------------------------------