--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13004 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1138       2004   0     Single    867    89        Good
tgactgcgtggccggggggaaacctgatcggccagatacagccgaaaccaggagggaggg
agtgggctttccggagggggagaggagggagggagacgaaggaggaggagtaagagagga
ggaaagaaagaggaaaagagtgcgagggagtgagggagggaggaaaataaacaacaaaaa
ATGTCCTCTTCCTCCCCCACCGGGCAGATCGCAAGTGCGGCGGACATCAAGCAAGAGAAT
GGGATGGAAAGCGCCTCGGAAGGGCAGGAGGCGCACCGAGAAGTGGCGGGGGGCGCGGCG
GTAGGGCTGAGCCCCCCGGCTCCAGCCCCTTTTCCCCTGGAGCCGGGGGACGCCGCGACC
GCTGCCGCCAGGGTGAGCGGAGAGGAAGGGGCAGTGGCGGCGGCGGCGGCCGGAGCGGCG
GCGGATCAGGTACAACTCCACTCGGAACTTCTGGGCAGGCACCACCACGCCGCCGCCGCC
GCCGCGCAGACCCCGCTGGCCTTCTCGCCCGACCACGTCGCCTGCGTGTGCGAGGCACTG
CAGCAGGGGGGCAACCTGGACCGCCTGGCCCGGTTCCTGTGGTCCCTGCCCCAGAGCGAC
CTGCTACGTGGCAACGAGAGCCTGCTGAAGGCGCGGGCGCTCGTGGCCTTCCACCAGGGC
ATCTACCCCGAGCTCTACAGCATCCTCGAGAGCCACAGCTTCGAGTCGGCCAACCACCCG
CTGCTGCAGCAGCTCTGGTACAAGGCGCGCTACACCGAGGCCGAGCGAGCCCGCGGCCGG
CCGCTGGGAGCCGTAGACAAGTACCGGCTGCGCAGGAAATTCCCCCTGCCCCGCACCATC
TGGGACGGCGAGGAGACGGTGTATTGTTTCAAGGAGAAGTCGCGCAACGCGCTCAAGGAG
CTCTACAAGCAGAATCGCTACCCTTCGCCCGCCGAGAAGCGGCACCTGGCCAAGATCACC
GGCCTCTCCCTCACCCAGGTCAGCAACTGGTTCAAGAACCGCCGGCAGCGCGACAGGAAC
CCCTCCGAGACCCAGTCCAAAAGGTGA
gcgccaactttcctcctcctcccccttcctctcccccacccccttcccggctttcttttc
ctccaagtgctcgcaaacatggcgcttaccttccccaccagcctggtccggctgcccacc
tctccccgccccctacctcgctccccggccggcagaggtagggggcggcggaggcggggg

Exon  2 +       4767       4893   2   Internal    127    90   Excellent
ctggctggtcggaatctgctgaaaggcctcttagtttaaataggactagcagatatcctg
ctgtgctttccttaaatactgcctttaatggatttagaagctggttttccaaacaagtgg
cactgtgtagaatgtcatccccctgaccttctgaacattttgatttccccctccatacag
TGAGTCAGATGGCAACCCCAGCACTGAAGATGAATCCAGCAAGGGACATGAGGATTTATC
TCCTCACCCACTCTCCAGTTCATCTGATGGCATCACCAACCTCAGCCTTTCCAGTCATAT
GGAGCCA
gtatatatgcaacaaattggaaatgctaagatatcattaagctcttctggagttctgttg
aatggaagcttggtacctgcaagtacttcacctgtcttccttaatggaaattcttttatt
cagggacccagtggagttatccttaatggattaaatgtgggaaatacacaggcagtggca

Exon  3 +       4845       5506   2   Internal    662    80        Good
ctgcctttaatggatttagaagctggttttccaaacaagtggcactgtgtagaatgtcat
ccccctgaccttctgaacattttgatttccccctccatacagtgagtcagatggcaaccc
cagcactgaagatgaatccagcaagggacatgaggatttatctcctcacccactctccag
TTCATCTGATGGCATCACCAACCTCAGCCTTTCCAGTCATATGGAGCCAGTATATATGCA
ACAAATTGGAAATGCTAAGATATCATTAAGCTCTTCTGGAGTTCTGTTGAATGGAAGCTT
GGTACCTGCAAGTACTTCACCTGTCTTCCTTAATGGAAATTCTTTTATTCAGGGACCCAG
TGGAGTTATCCTTAATGGATTAAATGTGGGAAATACACAGGCAGTGGCATTGAACCCACC
AAAAATGTCATCAAACATTGTGAGCAATGGTATATCCATGACTGACATACTGGGGTCTAC
TTCCCAGGACGTGAAGGAATTCAAAGTCCTCCAGAGTTCTGCTAACTCAGCAACCACCAC
GTCCTACAGCCCCAGTGTCCCTGTCTCATTCCCAGGCCTGATACCCAGCACTGAGGTGAA
AAGAGAAGGCATTCAAACAGTGGCTTCCCAAGATGGAGGGTCTGTAGTGACTTTTACTAC
ACCAGTGCAAATTAACCAGTATGGCATTGTCCAGATCCCCAATTCCGGAGCAAACAGCCA
GTTCCTTAATGGGAGCATTGGATTCTCTCCACTGCAGCTGCCCCCTGTGTCAGTGGCAGC
TTCACAAGGTAACAATCTCATTTGGTACCTTAATGCACCAGCAAATGTGTTCATCAGCTG
CT
gtaagtgacgcatttggtgatagctatagattgatgtttctgttcaggtaccttattagc
tgccgaagctgtagagtagccttgatgtgattctcctctttcacaatacccatgtcatat
ccaggttgctttattcccttgcatcatgaggatgggcttttattttactaacaactgaat

Exon  4 +      11009      11805   1   Terminal    797    70        Good
agagcctgggaatctgtagttttaggtgcccaaggtaattctgaaccagaattgggctaa
atgattgtatggaagtgttgcttctttatagatactgtacctgagaaaaaaacgtgtgtg
taactttttttctttccctctcacttccatcagtgataatcagtactttattttttttag
GTAATATCTCAGTAAGCTCAAGCACTTCAGATGGAAGCACATTTACAAGTGAGTCTACCA
CAGTCCAGCAAGGAAAGGTTTTCTTGAGCTCTCTTGCTCCCAGTGCAGTGGTATACACGG
TTCCTAATACAGGCCAGACTATAGGATCTGTGAAACAGGAAGGCTTGGAAAGGAGCCTGG
TATTTTCTCAGTTGATGCCTGTCAATCAGAATGCACAAGTAAATGCAAACCTGTCTTCTG
AAAACATCTCGGGGAGTGGCCTGCATCCACTGGCCTCCTCATTAGTTAATGTATCTCCAA
CTCACAATTTTTCTCTCAGTCCCTCTACACTACTAAATCCCACTGAGCTAAACCGCGACA
TTGCCGATAGCCAACCAATGTCTGCACCGGTGGCAAGCAAATCTACTGTGACATCTGTCA
GCAACACTAACTATGCAACTCTTCAGAACTGCTCCCTTATTACTGGTCAAGACCTATTGT
CAGTCCCTATGACTCAGGCTGCCCTTGGGGAAATAGTTCCTACAGCTGAAGATCAGGTAG
GTCACCCCTCCCCAGCAGTACATCAGGATTTTGTCCAAGAACATCGTTTGGTTCTGCAAT
CGGTAGCTAACATGAAAGAGAATTTCTTATCAAATTCTGAGAGCAAAGCAACAAGTAGCT
TAATGATGCTGGACTCTAAATCCAAGTATGTCTTAGATGGCATGGTTGATACTGTCTGTG
AAGACCTGGAAACAGACAAAAAAGAGCTTGCCAAGCTCCAGACTGTCCAGCTGGATGAAG
ATATGCAAGACTTATGA
actttatttcctcctcacctctttttggcatcagcggcaaatcttttcatgaagccccaa
ggacacaaaacattttcccatttaaaggaaaacactctagttttgcaagtatatgcatac
aagagactttagattgatctgcatgaagatcacagttaagtatacaggagtagaactgca

--------------------------------------------------------------------------------