--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (277156 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (48 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +         82        210   0    Initial    129    85        Good
ttaggcagactctgggctttttcattttagcattattgaggagcacctgaatggtcctga
agttggcctttgaatataccaATGGACAGGTATGAAATCCTCAAGATGCGCATGGTGGCCAAGAGTCCCACAGTCTCACAG
TGTGTGCGGTACCGTCTGCGCCCACCTTTCCTAGAGAAGAAACAGCAGAAAAACCTATTC
CTTCACCCT
gtgtgttgtggtgaatcttagtttttaaaggcacattattttattatataaacaacttgg
gaaccaataaaacacaagacatttgaaaagatgggtcttcgtatgggcacaacatatgat
aaggcaagtcactttcctcctctgagtttgggtttatttgctgactatcttccattttat

Exon  2 +       1323       1563   0    Initial    241    61    Marginal
aagcgggaagagcggcaggcagcggctcggcggagttgcagcagaggcggcggcgacgct
gagacaccgcagcttccctgagcgccgagtccctccggggacagcagcagggagcgcccg
cgcagccaccgagcctctgcccagccaagccgccgtcgccgcgccgggggaccgccagcc
ATGGCCGCGCCGGGGGATCCGCAGGACGAGCTGCTGCCGCTGGCCGGCCCCGGGTCCCAG
TGGCTCAGGCACCGGGGGGAGGGGGAGAACGAAGCGGTGACGCCGAAAGGGGCCACGCCG
GCGCCGCAGGCTGGGGAGCCCAGCCCGGGGTTGGGCGCCAGGGCCCGGGAAGCGGCGTCG
CGGGAAGCCGGCTCGGGCCCCGCCCGGCAGTCGCCCGTTGCCATGGAAACTGCATCCACA
G
gtaaggcgggcgccgctgcccctcaaatggcgtcggggaccagggccccccagtcagtcc
ccttctgcgcggctctcctgggcacctgcctcgcgctttctgccttgagcgccgacccca
cccccgcgtcgccacgggcgactgggaatattcgcgggctggtagaaaacaacaatttta

Exon  3 +      11187      11235   2   Internal     49    76        Good
cttagttacttcctagatacagtgggggtacaggcattgggtaaatatagccattctaaa
tgggagaaattggccaaaacaaaggggctacagtccccatgcatgtctgaaatccagcag
ggcagtcaaatcttaaagcttcaaaatgatctcctttgactccgtgtctcactgatgcag
GAGGTGGGTTCCCATGATCTTGGGCAACCAGGTCACACTGATGCAGGAG
gtgggttcccatggtcttgggaagctctgcccctgtggcttttcagggtacagcctccct
cctggctcttttcataggctggcattgagtgcctgtggcttttccaggcacatggtgcaa
gctgtcgatggatctactgttctggggtctgaaggacagtggccctcttctcacagctcc

Exon  4 +      12553      12753   0    Initial    201    62    Marginal
ttcagtatcttttcatgttttccagtatcttttcagcagcaccccactttactggtatca
atttactatattagtcagctttcataatgctgataaagacatacctgagactgggcaatt
tacaaaagaaagaggtttaatggacttacagttccatatggctggagaagcctcacaatc
ATGGTGGAAAGCAAGGAGGAGCAAGTCATGTCTTACATGGATGGCAGTAGGCAAAAAGAG
AGATTGGGCAGGGAAACTCCCTTTTATAAAACCATCAGATCTCGCTATCACGAGAACAGG
ATGGGAAAGACCTGCCCCATGATTCAATTACCTCCCACTGGGTCTGTCCCACAACACGTG
GGAATTCAAGATGAGATTTGG
gtggggacacagtcaagccatatcattattttaaaattattccatatttctcaaaaaata
aaccacatactaatgaaactggaaactgtgtgcatcacaaaaaccatagttaccccaaat
tgactacttaaaatgtgctcttcacagacttgtggccttttaaaaatcctcctctagttc

Exon  5 +      13532      13762   0   Terminal    231    47    Marginal
gtaaaatctgttatagaccaaattcttgctttctgagtttggaaaatttgttgacgctca
cattctccaaaattcctagaattttgttttatgcatagcaaatctttggctttctaaaaa
aaaaaaaaactactcttgaacaacagaaaattatgtgtatttgaatgattcctgatctag
TTGACAAGCAAAGGAATAGAAAACAATGTCATGTCTGCCTTTGGCATGAATTTTTCAGCT
CACTCTGAAAAAATCAGGGCTTCTCAAAATATGGTCTATAAACTACCTGCTCCAACATCA
CATGGAGTGACCACAGACCTCATCCTAGGGAAGCAAGCCTACCAGGTGCATGTTAAAGCT
GTAAGAAGCACTGATTTATTGGCTTTCCTGCTCATGCTTGGCATTTTGTAG
gagacgtggggaatagaggagcatgagccatgtaccctttccccatttcctcctgggcgt
attaccatccagttgggagatatggccaactcccacaaagcaaagatgaataactcaggt
cagcatgcagcttgttgcttggatggatggtacaagctatatgtgtgacacgaatttcat

Exon  6 +      21788      21901   2   Internal    114    82        Good
tttttcctaactgcagactaatgtaaatgttctgagcatatttcagatagatgaggctaa
gctataatgtttgagatacattgtgttttcaacatatgatatttttaatttatgactggt
ttatgaggatgtaaccccattataagttgaggagcacctgtataacataagggaaaatag
AAGTGTCCTACAAGACAACAAAGCCAGGACATGGAATTCAGCTTTACTTTGCAAAGAGGA
AGAAAGTAATGAGTGTCAACTGAAGAGACAGGAGAAGAGACACCAGAAGCAGAA
gtgagggtgaagagaggagcaatggggctgggaagaggtggcggtgaaaggagaggcttg
gcccctggaatggacacaaatagacaaaaaggaagaggaagtggaggaattcagaaaaca
ggaaagagagttaacagagaagtacacagagagggggaagccctttgaggaagcaaaagt

Exon  7 +      31406      31581   1   Terminal    176    61    Marginal
cccaaaagggcacatccatgaaagacgaattacaatgggaaaatgttgaatgtttcaaag
aagagagatgggagaatattttagttttggaattattatacaagtgaaagtctgaagtga
tataagatatagggtagcaaacatttcttgatcatgtagtatatactaagtgcttttcag
ACCACATCGCATTTACTCCTACGACAACCATACGTGGTAGATACTTCTTTATCTCTAACT
TGCAGATGAGGAAATTGAGGCACAGAGAATATAAGATTGTGCCCAAGATCACACAACTGA
AAAAAGAAGGAGCTAGTCACTTGAAAGCATGTGCTCTTAGCCACTATACAAATTGA
tggtggagaggacagggtggctttccatttacagctcttctggactctattttatgtaag
cctcacaacaactttctgagtggataaatgtgattcttgtttttatggatgggaaaaaag
agacagtggctagtgagctcaccaacatccaacttcactatcaataaaagtctgctgagt

Exon  8 +      49108      49275   0   Terminal    168    50    Marginal
accaaatggacgtaatagacatctacagaatactccacccaacagcaacagaatatacat
tcttctcatcaacacacagcacatactctaagatggaccacacccttggccgtaaagcaa
ttttcaacaagttaaaaaaaaaaaaacccaaattataccaaccatactcttggaccacag
CAGAATAAAAATAGAAATACCAAGATCACTCAGAGCCATACAATTACATCGAAATTAAAC
AACCTGCTCCTGAATGACTTTGGGGTAAAGAATGAGATCAAGGCAAAAATTAAAAAAACT
AATGAAAACAAAGGTACAAACTTACCAGAATCTCTGGGATACAGCTAA
agcaatgttaagaggaaagtttatagcactaaatgcctacatcaataagttggaaaaatc
tcaaaattaacaagctaacatcacacctgaaggaactagaacaacatgagcaaaccaacc
ccaaagcttggagaagaaaacaaataaccaaagtcagagcagaactgaatgaaactgata

Exon  9 +      52246      52403   2   Internal    158    53    Marginal
ggcgcgggctcaaggggccccgcactcggagcggctggctggcgctaccggcccaggcag
tgaggggcttagcacctgggccagcagctgagtaggatgcaccgggtcccccagcactgt
aggcctccccgcgcagtgctcgaattcttgctgggcctcagccgcctccccacaaggcag
GGTTCGGGACCTGCAGCCCGCCATGCCGGAGCCCCCAGCCTCCCCGACGGGCGCCGTCCC
CTGCTCCGCAGCGCCCGGTCCCATCGACCGCCCAAGGGCTGACAACAGTGGTCGCGCAGC
GCAGAACTGGTGGGCAGCTCCACCCACGGCCCTGGCAG
gtgagccactagaggaagccagctaggctccagagttgagggggtgggggcttggagaac
ttttatgtctagctggaggattgtactctgtgtctagctgtggccggggggggggggtgg
ggggtggggggggggtggtggtggtgtggatgcaccaatcagctctctgtaaaatggacc

Exon 10 +      53484      53638   2   Internal    155    54    Marginal
taccataaagacacacggactcatatgttcatcatcatactattcgcgatgacaaagaca
tggaatcaatctagattgaataaaatatcaatttaaatattcgattgaataaaaatattt
attaaataagtattttgaattaatattgaaataaatattaagcctctgactctgtctcag
GCACTGTGTGAGTGCTGGAGATATAGAGTTGAAGAGGATTCCATTCTTATTTCCTAGGAG
TCCCCTGGGGATTGGAGAAGGCAGGCAGTTTGCCTTCTTACCATGTGGTCAGCTTTCTAG
TGGTAGAGAAATGGACAAAGTGCTAGTGGAGATGG
gtgagagtggacagaggcctccagagaaatggttgtgcccaccaatgatggactgggtaa
agaaaataaggtacatacacatcatggaatactatgctgccataaaaagaacaaaatcat
gtcctttgcagcaacatggatgcagctggaggctattatcctaagtgaattaacacagaa

Exon 11 +      56724      56826   2   Internal    103    86        Good
ggaaaggggatgagcagtgaagtgatagctccaaggaagtgatagaaggagggctcctgt
gcacagggacacttgcactgtgtgctgtgggtcctcagatgctctgcttcacttccagtg
ctatcaccttccaagtataaaacccaagagggaaaattctatttttgtttcaagttacag
AATGGAGCTTTACACAGTGCAGGAGGGCGTGATTAGGATGGTCATCAGTGCCTATGATAG
TAACTCAAAGAAAAAGCTTTCTGAAATGAAATCATTTTTCAGA
gtaaataggagctgtctttttccaagtgattgcatctcagcagtaatatattacatgccc
tgtttggagtaaatgaataatgcacaagactgtgagtcttgagcaatataaaatagcttg
aacacactgttgtgaacaatatataatcttggctttaagttttactactatttctgctgt

Exon 12 +      65183      65334   0    Initial    152    61    Marginal
atctgagacttaaaattccatttaaaaatgttgttttactatttgcaatagcaaagacaa
ggaaccaacctaattgcccattaatggtagactggataaagaagatgaagtacatataca
ccatggaatactatgcagctataaataaagaatgagatcctgtcctttgcaggaacatgg
ATGGAGCTGGAGGCTGTTATCCTTAGAAAACTGATGCAGGAACAGAAAACCAAATACTAC
ATGTTCTCACTTATAAGTAAGAGCCAAATGATGAGAACACATGGACACATGGAGGGGAAC
AACAGACAGTGGGGCTTACCCAAAGGTGGAGG
gtgggaggagagagagatcaggaaaaatgactaataggtactaggtttaatacctgcatg
atgaaataatctttactataaacccccatgacacaagtttacctatataacaaacctgca
tatgtaccccagaccttaaaataaaagttaaaaaaatgtaggtttgaaaggtaaaatatg

Exon 13 +      77252      77311   2   Internal     60    54    Marginal
acatttggatacctagataaaaatgacatatctcagcctcctatttagttaaatatggcc
atataaccatcctctggtcaatagactatgactacaagtgatgtatgctacttctgaatt
gttccctgaaaagaaaagggtatgttctttcctttctttttcctttctctcatcctttag
CCAAGAACAAGGGTTTGGTGATGAACCACCTTCAACCATACAGATGACAACACATCCTGG

gtgtgacagggcaacaagatggaaagaaccttgctcccaacaccatggagcagacatgga
tctttgttacagtaattaaaactgtattctaatatagttgggaagcaggaggaagatgtt
tcagtcaagtgtctttgtgttgcaactaacagaaactcaattcagaatggtcaaaacaaa

Exon 14 +      80493      80594   0     Single    102    62    Marginal
atgtggcagaatgcacatcttcagcctctgtctgctgggaggagagtgggatccactgct
ggctagaggaaggtgaaacagaggaataggcaccttagtctttctgaatgaagtttcctt
ggttttaccctgagctgggataatgagtctaacaccccttgtcaaacggggaatgagaca
ATGTGCACCCAGGTGCAGCACAGAAAGGAGAGCAGCATGCAGGTCTCTGCCACCCGTAAC
TGCTTAAAGTCCCAGCTGAACTCATCCCTGGAGGAAACCTGA
aattctcaactgtcagactgaacatataagaagatgaagaggtgtcagataatatggagg
agagctggggaacaattatattgtcttgacagaactgttcaggttaactatgagcaagga
aaagaaaacacacggaaactaggataaagagtaaaggagcaagaagggaaacaaaagaga

Exon 15 +      83895      83955   0    Initial     61    53    Marginal
attgctggaaatttgccttcttgataaacttgcaaaatacatcaatttatgtgtacaagg
acatttattggagcattgttataaaattctgggaaaaaagttaaatttccactgacagca
gtccatttaaaaaatcaaagtacattcatacaatgaaatacctgcgaatcattacagaga
ATGAGACAGATCAATAATTGTAAATGTGAAGAGCTCAAAGATGTATTTATTGGGGAAAAG
G
gtaagaaagatcccatctagtgcaatcccttatcaataaagtgtaaggagtttaaataca
ggtatagggaaagaaaaaggtatagaaatcgatttaggctaatgtatgcataaaataatt
taccgaaggatatatacaagaatgaacgatggggactcggaagggagaggaaccatttct

Exon 16 +      88331      88472   0   Internal    142    77        Good
aaaacatcccttcattgtttttgttttaccttgggttatcctcaaagaaaggaaccctca
gtgtctgatacccctgtgctattcaggtaacactggccccactcccttctcccttattct
agggaaaagcagaaggcttgctctcactatttccattgcatctttgatttctgagtccag
AGGCCGCTCATCACTGCTCTCGACAAGGAATACCAACATCCAGAGCACTTTGTGAATTTA
ATCTCTTTGCTGAAAATCAGAGGGCCTGTGGTGGAGGAATCAAATCCCATGTCACACAAT
TTTGACCTCACCTACTCTTTCT
gtctcccacgtttccactttcccagctattttgtcttccatcccttccaaaattcagctg
acatattattccctaagcacccagcctcttgaggaatgaatgtaatccaaaccccactcc
aactgcttttctcataaggtataaccccaccagggcacctttcttgcttccctctctacg

Exon 17 +      89771      89841   1   Terminal     71    74        Good
tccaacagattttgttagatagtgttgctggttgactatcttccagtaacaatgccttca
tgacccacttttctgtgagtctatgtactcttctatcctatgtcttaatctgtttgggct
tctgtaacaaaataccataaactagatagcttataaacaacagaaacttatttcttgcag
ATCCAGAGGCTGGGAAGGTCAAGATCAAGGCAGATTTGGTGTCTGGTGAGGACCCATTTC
CTGATTCATAG
acagtgccttttcactgcatcctcacattgtggaagggactagctagctctcagtggtct
ctttaaaagggcactaatcccattcatgaagctgcctttatcatgatctcatcacctccc
aaaggccctacctcctcataccatcgcttgggaattaggatttcaacatatgaccattgg

Exon 18 +      90717      90893   1   Internal    177    51    Marginal
ttcacattcatatatgcatattcagcaagaacaattggaacagaacactaagtggaacat
aaacagtcaatgactgacactttggagatttttgtttctataacagtattaaattctaca
ataaagttattttaaaacaaagaaaatggcccaagaggtgttgctctgttttttgttcag
TGAACAAGCAGAAGGGAGCTGGCCGAGTGATGGGGAGCATGGGCTCTGGCATCAGGGAGA
CTTGGGTTTGGATCCTAGGCCCACTTTTGGTCCAGACACTTCCATTTCCTTATCTGCAAA
ACAGGGATAAGACACCAGTTCCACATGGTTGTTGGGGTACTAAACAAGATGGTGGAA
gtaaaaggactctttatgattatgatataattattacatgttattacatactgataaaca
tgccttctatgcaggtgccatgccctggagtggcatccagtgatagtactgtagggagag
gggagatggaatcagaatttggggggcttcctctctttcccagacaggcgtctccacttc

Exon 19 +      94694      94901   0    Initial    208    88        Good
ctaaaatggtatgtgtgtagccttgttgcagctttagcaaatataatctggtctatttcc
aattgatgagtaactattattgggagaagaggaagtgttgaggggtacaaagtctgtggg
taaagaagaaagacaaacagtcaaacacaaaagcaaccagactcccagggattttagaat
ATGTTTCTAAACCAAGAGAAGATGATGAATCATCATGCCTATGATCATGGTGTGCACCAT
TTGCTCTTCTCCAATAACACGGTATCGGACCAAAGACAGCACAAGGTAGAGTCTCTTACT
CTTCTGCAGTACAGCCAGAATTTTATTACTGAGATTTCCATGCCTGAAGGACAACATTTG
CTCATGCTGACATGTTCAGTCTTCCTAG
gtgagggacatgtcactccgtaatgaacgcttgcctgttgtagcctttcagtgatggtag
gtggattatttttagtttaagagctgtaactcaataaataatttagaatatctatgggag
tttcagagtaccaattaatctcactcatgtccctctgagttctgagccaatccagtcaga

Exon 20 +      95201      95262   2   Internal     62    63    Marginal
gtttcagagtaccaattaatctcactcatgtccctctgagttctgagccaatccagtcag
attgaaacctacattgttgctttatttctggtaaactgagttggaaagcacagcctggac
ttgtggtaaaataggttttttacgcctcctcctgaaataaatttttcatctggtccccag
CAGAGCCTCCTACTGGATGAAGGAAAGGAGTGACATGAAGCTCCAAAGGAGCATCAGAGA
GG
gtaaggggaaggccccacacagcggaggaaggctaaacctcttctggttgagaacaaatg
agatagagagaagggctaaaaatctcctcaccaaacactttcaagatgaacaaagttcct
atttttgaatgtcttagcccatttcatgttgctataatagaatgccacaggttgggtaac

Exon 21 +     100201     100396   0    Initial    196    79        Good
tttaaatgcagatatttcttcttactgcgtatctaattgtctaataactcttaaaagcac
aatgcaaaatggcatgaatccatacatgagtaattcttctgggaatgctgtctcatatcc
acaggaagcataattgggatgacataaaagccttctatttactgataaggataattgaac
ATGAAGCACTTCTGTGAGGATTTCACCATATGGGAGGAGTTACTCCATTCCACAGCTTAT
TTGAAATTTATGGTGGATACAGCCTCGGTGAAAGAATATCTTTATGACTTCCAGCAGCCA
TTTGGCATTTATTATGAAGTATTTTCATGGCTGAAGATACAGTTTTCTGTTGCTAATGTG
CCTCACACATTGCCAT
gtgtatgagggatgtgggagtttaataaataatatttgatgataagacttaatttaggca
tggcattttatggaagcttatgattcacatacctctgtggtactcacagatgcacttgag
ttttggttctgtaaaagttaagaagccaagttgacaccttaaaaagcaacacctgcactt

Exon 22 +     103418     103549   1   Internal    132    86        Good
cacatggagttaaataaaacgaaaagaacagaaccatattagcatgttagtggcaagatt
ctaataaggttatcccagggctaagcctcccctctttccaaccctgagtcattgataggg
tagaaactggagtggggagtgaaggtgcagaggacgtttagccttctacacacaatccag
GGCTCTGTGGTAGCAACGACCAGATCAAGAGCCAGGATGCATTCAACATTCTAGGAGTAG
AGTCACACCCCAGTTACCTCCAGTTGCCTGGCCCAAACAAGGGCAGAGAAGAGTATCTAA
ATCCTGATTTCG
gtcactggatcattaccacatccttagaagagctatcttaaaagataacaaattcctgtc
tttgtgttgccaaagaaaagtctataaccagataatgtcatttatagggaattttttaaa
aaacacttatcaagttgtactttgtaaatgtgctcattcaataaaatgtattgaactctt

Exon 23 +     111179     111292   0     Single    114    47    Marginal
cccctctgtatcattattgtccctctgactcattttgtatcattaggtccaggtcagatt
ttagagggaccaggatgaactacagtgtattctctggttggaactagcacgatgagtctg
gaaacatattcattgatgtgttccataagtacttaccaaacaaaaatctaggtgccaggg
ATGTGCTTAGCGCCAGAGAAAAGTGAAGCACGTTGTGCAGTCCATGTTTCCTATGAGCTC
ACAGTGCAGGGAAAACAAAACGTGAAGAAGAGGATGAAGAAGGTTCTAACCTGA
aagatgagaacctaagagaggccatagctgtcttcaaatgtttgaaagtctgtcatgtgg
aagaaggaagctgggctgggggttcccatcatagtttgtgcaacactcttactatcatcc
taaattgttttctttttctttgtttttaaatgaaattaaagttttaaagagtaatacatt

Exon 24 +     114186     114236   1   Internal     51    98   Excellent
cagagaatgtacaccaccaagagtaaactttaatgtaaactacagactttgggtgatgac
atgttgttgtagattcatcagttgtaacaaatatactatgtgtcttggtcagtttgggat
gctgtaacaaaacaccataaactaggtggcttataagcagcaaacatttatctcttacag
TTCTGGAGTCTAGAAAGTCCAAGATCAAGGCACTGGTAGATTCAGTGTCAG
gtgagggcccattttctggttcatagatggcatctcctctctgcgtcctcaagtagtgga
agaaacaaaggcgctcccttggctctcttttacaagggcactaatcccatttatgagggc
tctgtattagttcattttcacactgctaataaagacatacccaagactggataatttata

Exon 25 +     125472     126245   1   Internal    774    78        Good
ctatcggggagattaggaaatttaacatgctggtgctctgagggagctccgagggaactc
cgagggcttaaggagaaaggatgtcatgtcttcaccaggcaggggtgggtggtgggttag
acaagagagagagctgacgccaagcacccactcactgtctgctgctgctttgattcatag
GTGTGGCAGGTGTTTCCAGTGCCATGGACCACACCTTCTCAACAACATCAAAAGATGGGG
AAGGATCGTGTTACACATCTCTCATTTCTGACATCTGCTATCCACCTCAGGAGGATTCTA
CATATTTTACTGGAATTCTTCAGAAGGAAAATGGCCACGTCACCATTTCAGAGAGCCCTG
AGGAGCTGGGTACACCCGGCCCCTCCTTACCAGATGTGCCTGGGATAGAGTCTCGTGGCT
TATTTAGTTCTGATTCTGGAATAGAGATGACTCCTGCAGAGTCCACGGAAGTGAACAAGA
TCTTAGCAGACCCTCTGGACCAGATGAAAGCAGAGGCCTATAAATACATTGACATAACCA
GACCCGAGGAGGTGAAGCACCAAGAACAACATCACCCCGAGCTGGAAGATAAAGACTTGG
ACTTTAAGAATAAAGACACTGACATCTCAATTAAACCTGAAGGAGTCCGTGAACCTGACA
AACCAGCTCCTGTGGAGGGAAAAATCATCAAGGACCATTTATTGGAAGAATCCACATTTG
CTCCATACATAGATGATCTCTCTGAAGAACAGCGCAGGGCTCCTCAGATCACCACCCCTG
TCAAAATCACACTGACGGAAATAGAACCTTCTGTTGAAACCACTACCCAAGAGAAGACCC
CTGAGAAGCAAGATATATGTCTAAAGCCAAGTCCTGACACAGTCCCCACTGTCACTGTCT
CGGAGCCTGAAGACGACAGCCCAGGATCTATCACCCCTCCATCTTCTGGAACAG
gtaaaggccctgttattgcttgacttaggaaaacccagcatatggaaatctcaatcccta
aaacaaatattaaggaatgacaattttcattcaacatactttactatctggaccccttaa
atttcatttagtttaactaatttaattaatattcaaagttttcaatttgttgctgattgt

Exon 26 +     128080     128182   1   Internal    103    49    Marginal
aaccatagaactccaagggtcttaaagattcactgcgccaggtccctgattttcaaattt
actcattcacgcaacaaacactttctacatactttcttttggttgggtactctatgaggc
acgactgatggggaattaacgaaaaataaaaaacaaacaaaaaccagtccctgcctccag
GGGACCAGACGACCAAGGAAGCAGTCCCAATCCAGTGTGCTTGGTGTCCTGAGAAAGGGA
ATTGTACGGTGCTGACGAGCCCTGGAGTCCAGCAGCTCCCCAG
gtgaactgggaccacaggtgactctcagaggaacaggggaaacaaagaggtgaagggaag
ggtgcccttccagtctgaggagctgcatggacatggagttgtgagggcccagtgaacttc
acttaagatgtaaattgagatttgggtagtaatgacaaatcagaaaaccaaggctccagg

Exon 27 +     130221     130442   1   Internal    222    58    Marginal
ggtgtgaggggtccaaggactgcccctctgaggagatgacacatgaactgaaatctgaat
gagcagaaggagcccacagttcagagagaagctaggagggacctcaggtgtgggggaata
gcaaatgcacagggcctgagtctgtattatatgagaactgaaagggggttggtgacacag
GGGAGGAAGAGGGAAGTGGGGCAGAGAACACCATTGGACAGATAGGCAGGGCCGAGATCG
TGGGGAAGGAGTTTGGATTTTGTTCCAAATGTAATTGGAAGCCATTGGAGGGTTTTAAGC
TGAAAAGTAACATCATTTATTCTTTCATCTATTTATTTAACAAATATGTGTTGACCATTT
ACTCCACATCAGGCATTGTTCCATTACTGCCAGGACTCACGA
gtgagtgatgcctcacaagaaaatcctggcttcatggagcttacaatctagttgagaaga
catacacacaaataaccaaatatataatataatatcaggtagttataatggttatgaaga
aaaatacagcaaggcaaagtgtaagagagtggtggcggtgggggtgaggagaggcttctt

Exon 28 +     144285     144562   1   Internal    278    84        Good
ggcctgtctttccagcatagccctggaaacagattatttttgtgctaatgagatatgtgt
ttctcaagcaacgacaaaacatctcgcctaatggaattttgttttatccctcctctctct
gtccatctgtctgtccgtgtgtgtgcctccgtggctctccttcgctctgtgggacgacag
AACCATCTGCTGCAGAATCCCAGGGGAAAGGCAGCATCTCCGAGGATGAGCTGATCACCG
CCATCAAAGAAGCAAAGGGATTATCGTATGAAACCGCCGAGAACCCACGGCCGGTGGGCC
AGCTGGCCGACAGGCCCGAGGTCAAGGCCAGGTCCGGACCGCCAACCATCCCCAGCCCCC
TGGACCACGAGGCCAGCAGCGCGGAGTCGGGGGACTCAGAGATCGAGCTGGTGTCCGAGG
ACCCCATGGCCGCGGAGGACGCGCTGCCCTCAGGCTAT
gtgagctttggccacgtgggcggcccgccgccctcgcccgcctcgccatccatccagtac
agcatcctgagggaggagcgcgaggccgagctggacagcgagctcatcatcgagtcgtgc
gacgcctcctcggcctcggaggagagccccaagcgggagcaggactcacccccgatgaag

Exon 29 +     168295     168381   0   Terminal     87    49    Marginal
tgttggctaacaaccaaaatttcagttacatcattccatatagatagatagatagctggt
ttacttatataacaaatatttgttgttacatcttatacatcaggcactgtttgaggcact
tgagatacttcagtgaacaaaatgaagatttgtgctctcacggaacttacgttcttgtag
GGGGAGAAAGACAAGAACAATAAACATAATGTGTTAGTCCGTTTTTGCATTGCTACAAAG
AAATACCTGAAGCTGGGTAATTTATAA
agaaaagaggttttattgactcatggttctgcaggctttgcaggaagcatagtgctggca
tgtcattctggtgaggcctcaggaagcttccaatcagaagatgaaggacggcagccatgt
caaatggcaagagtgagagcaagagagtgagatgggaggtgccacactcttttaaacaat

Exon 30 +     172690     172998   0   Terminal    309    79        Good
ttactcaatattagatggaacaagttttgttttgtttcttttcctcttatgaaaaagata
agtgatttcatttcctagtaaaggtattctagtttgactcataaatttgcaggacacatt
cttttctttattaacttttgtttttattttattttattttttatttttttatttccatag
GTTGTTGGGGAACAGGTGGTATTTGATTATGTAAGCACTTTAGCAGTGATTTGTGAGATT
ATGGTGCACCCATCACTCGAGCAGTATACCCTGCGCTCAAAGGATAAAAGACACATTCAT
ATTAACCATGATGATATAGAAAAGTGCAGCAGTTTCAGCCACCAAAATTATGTTTCCAGC
AACATCTATTTTGTTGATATAGATGACAACAAGCTTCCAGCTGGAACAGATTCAAATGGG
TTTCCTCTTGCTCAATATTTGAATCTACTCCAGAAAATGATGGCTAGACTAAAAGGAATC
AAAATATGA
ctcagcaactccagttgtataggtaaaatgcagactgccaattacaactaaaagttcaga
aatgctttagaagtgtaaccttgtagtgaatttatctggcacataaacattaagtctagt
gcttacaggaagatagaattgtttttcaggcacatttttagcttgattcttaatgcctta

Exon 31 +     189413     189495   1   Terminal     83    78        Good
tgctctgtaagtatacatttgattttgttccctagagacaattgtttctgttttatgaag
tgtgaaacattactcattggcaattatgagtaacttttatacttgttaagttttattgtt
gtgttaatgtaaacagaaacacttgtgtttgtttccatttgttcaatacacatttattag
GCATCTACTTTCGCCAGAAGCTGGGAGATACAAAGATGACCATGAGTCAGTTCCTGCCCT
CTAGCAATTCAAAGGAGACATAG
gtataaacttcaacagcaggaaaggcaagtggaatccttctgtgggggcagaagtagtct
atctacccagcagccagcacaatgcatggtataacattggatgtgtaataaatcttgttc
aaataaataaaataatcatgagaagatgtaccagaaatagtaatgccataaggaaaggaa

Exon 32 +     194712     194858   2   Internal    147    75        Good
actatttttattaccagattataaccatgatttcctcattgaccacagcagtggggtacc
agcatccctggaaaaagatgtcttgaatatcctacaatgaatatcaaatggagagagcct
ctgcctgttcaaggctgaaaatctgagaaaaataaaactcacgttgctttttaaattcag
AGATGTGACCACTGTGAATGTATTGCATCAACATAAGTCAAATATTGGTACCTATGGGTA
TAGAAGGATTCAAAGGCTGGGGTCCTGGAAGAAGAGGGTCAGAAAGCATCAGAAGGAGGA
AGAGCAAGACTTGCAGACAACCCTGAG
gtgggagccagctcccctcactcagaaagtgtgggctggtacacccgataggaatggagc
agggcgcacatggagatttggggtgagctctcctttcctaagtagggtacactgacaatg
atcaatctgttcccatcatctgaacttataatgccttcccagaaaacctctttgggctac

Exon 33 +     195556     195584   1   Internal     29    56    Marginal
ttgcatgtgccctttgccctcaaaagtcttttccaatcatcgattaggtaggtatcatct
aagcttgggtttctcacataatttcgttaatgcttctttgcttcaaattttgacttacct
ttaaggccatataactactgatacttaattgaacctgttctctaattgccaccactgcag
TTACAAATGATGATGATGATATTTTCAAG
gttatttatttatatcacagaaaagaacagtagcacttgctatatacttagagctttctg
aggatcagctatacacataagacactgactcattaatttttacagcttctgtgcaaaaac
tagctaaaattgctttccacttcaagttgaagacagttagtcataagtatacattccagc

Exon 34 +     201974     202102   0     Single    129    47    Marginal
cactaggcactattgcaaaattcttagtatttcccttctatgatgatttattgagaatgt
ttctgttatgttgatgtactgggcaatttttgcaatagcaacccattcatttagttattc
tatttgtcgttgcacactttcaaagtgatcaatgatgaccttcaaataaaatattggaaa
ATGTCTAACTCATTCATGGTGAGAGAAATGAGCAAAAAAATGGAGACAGAAGATTTTGTT
GCTCTGGAACAAGGAGTCTGCATGATGAAGGGGCCAGGGAAGAGGTACAACAGTGCTACT
GAACCTTAG
tgagtttaacagtagaaatgcttttggctgcaagtgacagaaaatccactcatcggcagt
gtgaaccttaaggttattcactactcacttaataagaactttagagcaaggagatctcag
agacataggtgacttgacagagctctagtgccagggcactagacttacagagtattcctc

Exon 35 +     206925     207086   0     Single    162    50    Marginal
tgggtaacttgacctttctctctggctgcccttaacacattttccttcatttcaaccttg
gtgaacctgacataagcagacatttcaccaaagaggatatatagatgttaagtaagcatg
agaaataacatcagagacaatgtaaactaaaaccacaaggagactaacaacattaacaga
ATGGCTAAAGTCATAAGCAGTGGCAACACTAAATGCGGCAAGAATGTGGAGATACTGGAT
CACTCATTCATTGCTGGTGGGAATATAAAGTTGTACAGCCACTTTGCAAAAAAGTTGGAT
AGTTTCTATAATGAAACATATAATTATCCTGTGACTCAGTAA
ttgcactctggcatttatcccagggaaataaaaacttacgcttgcacaaaaaaaaattat
acacagatgttcacagcagttataatagtcagaagctttcttcagcaggtgaatgatgaa
acaatacatggtacatccataacatggaatgttactcagaaaaaaataaataaaaaggaa

Exon 36 +     212607     212695   0   Internal     89    73        Good
tctgatgggcttccctttctgggtaacccgacttttctctctggctgcccttaacatttt
ctccttcatttcaaccttgatgaacctgacaattatgtgtcttggggttgctcttctcaa
gaattatctttgtggtgttctctgtggttcctgaatttgaatgttggcctgccttgctag
GTTGAGGAAGATCTCCTGGATAATACCCTGAAGAGTGTTTTCCAACTTGGTTCCATTCTC
CCTGTCACTTTCAGGTACACCAATCAAAT
gtaggtttgatgttttcacatagtcccatatttcttagaggctttgttcattccttttca
ttctttttttttttctctaatcttgtcttcacactttatttcattcagttgatcttcaat
ctctgatatcctttcttccacttgatcagtttggctattgatacttgtgtatgcttcacg

Exon 37 +     226217     226465   0   Internal    249    58    Marginal
taagacactctggtcatctgacttgtcagagttcttgtgttggttctttctcatctctgc
atttaggtgttctcttaactgctgggctgcctctgattgaagcggtcaggcaggggcaga
gtggttgcactggagtcctgggcctggtaactctgcccagtgaagagaagtgaggaccag
GACCTGCGTGGAGAACAGTATGGACACTTTTCCATTAGGTGGATGCTCTGTGCTGGGGGT
TCAGACCAGTGCCGGGTCCCCATGGACTCTCTAGAGCCTGGAGACAAGAAGGGTGAGGGC
TGTGAGACAGCAAAGATGGCAACCCACCCCTCCCACTGGGAGCTCTGTCCCAGAGAGCTG
AAGAACTGCTACTGGCTCAATAGCTCCAGTGGGGAAAGGCTGGAGACCCAGGCTGGGAGA
ACCTGCCCA
gtgaggagatacgggaacagggactcatgtaacaaacatatagaaaacatgtaacatgta
gaaaacatgtaacatatagaaaacatgtaatatatagaaaacatgtaacaaacatatata
aaagtctggccacttttccattgggctgctggaatatgcaggaggtctgctccagtttct

Exon 38 +     239961     240105   0   Internal    145    56    Marginal
gaataatttcagatatgttacaaagatacgcagagaggcccagctggtttctccacaagc
ttgtattctgaaaagaatacacatgatcccaaagatcgtattttaaagtgtatatgcttc
attaaaatgaaagatgataaatcatgtctacaagcataaccttgagattactgtccttag
GCCCATGCTGGTGTGGGGTATGCAAATGTAGATTTTGATCTGGGAAAGAACACCTCTGGC
AACTGTAGAAGAATCGGGAAGGCTCCACTTCTCTATGAAAAAGACCCTGTAATGGATAAG
GCCATGCCACAAGATGAAGTGGAAA
gtttgttcctgctccctctgaactcttctgtatgctcccgtggtctccagggcattctct
gtcctcatgcagtgtcttgtctcctctagggaccccttccaacagtaccttcttttccag
acaatgcccacattccagtcctttctctttcctatttctaccttttcttcatcaaaatac

Exon 39 +     248363     248495   0    Initial    133    84        Good
ttttttaaaaaggaaccaacagctgtctacctcctggttcttttctattccactacaatg
atgggttttaagaagggatgacacaatcttaagattttgtggctaattatggttgatgac
caatagaccaaatgaacagtttgtattttgatgaggtcaaaaagcttaaagaaatagtac
ATGAAGACAACCATTCTTGAGTATCTCAAAATTATTTCTTCATGCCTCAACTATCACATT
TCCAAAGCCCGTCTTTTCCTCCCTGTGACCATCTCTTCCTTTGATCCCGGTTATCCTGTG
AAGATCCCTCCAA
gtgagccttggctttacaagaggtctaggaggaggaggagcttgcccaactgtctgaaat
tcacaggacctgttgtttcacttcctgggcaggcccaccccaccatggtgaccaagggct
tacacatcattatgttaacttgacagcttggaaagaatgggaatgttctagtcctagtgg

Exon 40 +     249075     249206   0     Single    132    40        Poor
catttaaagtggtggattaaatgctatgctcttttactatctatagaaagcaccaggctt
aatgtgtctttcctttcaaaacatccacagaattatttaagagtctagaaatagtgttgg
catttttctcttgacagtcatataggttgtagttaggaggtgtgagggaagggctggaaa
ATGAAATCAAAGGTGTCTTATCAGCAGAAGTCCGTGCCAGCAGTTTTCCCTCTGGGCTCA
GGGCTCCTAGATTACCATGTGAACCTTCAACTGATGTGGGATACTATCTTGGTAAATGAA
ACTCATGACTAG
aagatgtcatctttgaaggtctctatgtttacatctacttctgttttctttctccagttt
aatgtcaaacgagggaagattaaagtaggaaaaattacttctattttttcttgttaacat
tttgtggtgatattttgtttccttcatgaaaatcagtcagaaaaaaactggctcttaatc

Exon 41 +     259616     259784   2   Terminal    169    75        Good
gcctaagactagtttcacaaatccttttttctattaatcaaaccttgcggaggagaccag
taatttactgttttacccagacagagaaagggagagagagagagaccagaaacttggctg
gtaagaatttcttaccctttttgctggcataccaggtttctgggttccttttctctgcag
CTTCCAGAAGAATGGAGTGGCTTCTGATGACCCTGCTCACTTGTGCTATAGCAGTGGGGT
TCCAGCCACTTTACAAGAGAAAATCACCCTTTACTGTTTTATGGAACCACAGGCAAGATT
CTTAATTTTCAAGATGCTGCCCAATGGGCTGCAAGGGGAACCGAATTAA
cattttccatcccagcaaaatacacataacaaaacagacattagtcacctcattcagcac
ccaatatcagcctggaaaagctgaaactttttccctttggtccctgttgtctttaatcca
ctccaggtggggacagatgacctccaaatggtaattcacaatggggtctctgggcaaggc

Exon 42 +     264461     264668   1   Internal    208    97   Excellent
caaaccaaagtggaatgacagtaagtgcccttggcacagccatctgtctgctcacttgtg
tttaggaatccagatgccaggtgagaacccacagcaaccacagcttggtggagtgagcca
cagcggctcatgtggcggcactgcgggagctcagctgggtgtgtttggtgtctcctgcag
CTATTGACCTGTTGTATTGGCGGGACATCAAGCAGACGGGCATCGTGTTTGGGAGTTTCC
TGCTGCTGCTCTTCTCCCTGACCCAGTTCAGCGTGGTGAGCGTCGTGGCCTACCTGGCCC
TGGCCGCACTCTCAGCCACCATCAGTTTCCGCATCTACAAGTCTGTTTTACAAGCAGTGC
AGAAAACCGACGAAGGCCACCCTTTCAA
gtgagtgcctcagctgaggagccctcacccactgaccaggggcttttaccctcacctgta
tttcagctcacagatgcacttgagtcatgtttctctgagacccaacagacctcttagagt
ctcccctaacaccctgtctttgaatatctaacatttctggtgaatttctgaaacaaactc

Exon 43 +     266447     266591   2   Terminal    145    79        Good
tgcatggaagcaggtgtgtacggtgccctgtggccctcactggctggcataaccccccag
agatgactcctgctctcaccctcagagtgagagtaggaacgcttagctgttactggggtt
cggcagcctgtctcatgattccctctgacggaattttctgtgggaatggtttgttgacag
GGCCTACTTGGAGCTTGAGATCACCCTTTCTCAGGAGCAGATTCAGAAGTACACGGACTG
CCTGCAGTTCTACGTGAACAGCACACTTAAGGAACTGAGGAGGCTCTTCCTTGTCCAGGA
CCTGGTGGATTCCTTAAAAGTATAG
ttgcttaagctgttcacttcacagtcttgactgttattttccctaaaggtgtaatactgt
aaactgctacatcaagaagaataaaaagcaagtgctaattatattctagagtcagaagac
ctccagttgtatggcaccatgaaccagtctaatcccttcattgtaccaatgatgaaaatg

Exon 44 +     267761     267956   0    Initial    196    58    Marginal
attgtagcacaaaagcagaaaaagacagtacaaaaaggaagggcttgactgtgtgcccat
aagacttctgaacactaaaaatttgattcaatatcatttcatatattagaaaatattaat
cttgttttgattttatttgaacatttaaaaatgtaaaaacctttattaactcgtgggcct
ATGCAAAAACCGGTCAAGGGCCACAGCTTCGTAGATTATTATTTCCTTGAGTCCCTCAAA
CCTTATAACAAAGTGATCCAAATAGTTCCAAGAGAACTAAGGACTGGATCCTCTTTCATT
GATTCTGTGATGAGCTTTCAACGCCTTTCATTGACTATCGAAATCATGATGTATTCTGAC
TCAAATTCAAATCTAG
gtaaaagtcaatgatatgagactctaacttgtcaggaagggttttaggagctctaataat
gctttcgttcttcagtttgcagtcctgatgtggctcctgacctacgttggcgctctcttc
aatggcctgaccctgctgctcatgggtaagagcagataagactgtatacgtcttccttca

Exon 45 +     268032     268101   0   Internal     70    89        Good
gagaactaaggactggatcctctttcattgattctgtgatgagctttcaacgcctttcat
tgactatcgaaatcatgatgtattctgactcaaattcaaatctaggtaaaagtcaatgat
atgagactctaacttgtcaggaagggttttaggagctctaataatgctttcgttcttcag
TTTGCAGTCCTGATGTGGCTCCTGACCTACGTTGGCGCTCTCTTCAATGGCCTGACCCTG
CTGCTCATGG
gtaagagcagataagactgtatacgtcttccttcaccccctctgtgaaaacgctgcttcc
taggctgtaagctttttgtttgtttaaagagattcctaggaacaaatgccagatatccct
gagtgcagagcacttctcttaccatcatagttcaattaaagagtataatatatattatac

Exon 46 +     268830     268888   0   Internal     59    98   Excellent
attgataactcagaattttaatactatatttgtttttcatcccagctgtggtttcaatgt
ttactctacctgtagtgtatgttaagcaccaggtaagttctatgtgatgtcaaaaaatgg
cattgaattttgacctcatcatctttggatatgctcattattttttttttctttatgtag
GCACAGATTGACCAATATCTGGGACTTGTGAGGACTCACATAAATGCTGTTGTGGCAAA
gtaagtcacatagtgcaatgcataaaaggagagactctcttacatcagcatttgagtgga
ttaggataggggtaatgagaagatagtaaaatgatagattgatttatggtcattcactta
ctggaatcatatattcattctcttctcaattatgttattttagaaaataagcataagttt

Exon 47 +     271646     271788   2   Internal    143    85        Good
ttgttagaatcagacagactgagtccatttctggcatttttagctgtatgagctcatcat
aaatgttatttgactctatgagcctatttccttatctgtaaattggaaatgttaatacca
cacagggttcttggtgattaaatgaggtaatgtctgtaaagtattcttacttggatgtag
GAAACCCTCAATATTATATATCATTGTCATCATCATCATCATCATCCGATTACTGCTTAG
AGATCGGTTCATGGGGCTTGGAGGTAGAGGACAGTCCCAGATTGGGCCAGTAGACACCAG
GGCCAGTCTCTCCTCCATACTGA
gtgaccctgtctaggtcgtttcacctttgtttgtctcagttttccagcttaaaatagggg
ttaataatgcataataacacttcttagagttttgaaaatgaggaaaaaagcctcaaattt
caaaaggcaaaataaacactgtagaggaaattaaagcttcgagtaagtgagaccataata

Exon 48 +     276009     276046   1   Terminal     38    92   Excellent
gttactaaaaagtaccagcatgttaactttattacaatttgtattactttctctgtagtt
cctaatggattcaattacggactctggatatttgcacttatgtacttgatactgaatgca
taaataaatgttactaaatgtagaatgttctccctctcttctcatgcatggtcttaccag
AAAACACAAAAGCTCGAAGTGATGAAGTCACTCGATGA
cattctaggagggctgagagcaaatgctcaccttatttctctctaggactgtggagtcaa
actgcaacctggcttacggtttttctgggtcattaatagaaaactgaaaagtggtaaact
gtcaatcactcttcatattgtactctgtcaggtggatgcagatatttaagatagttttta

--------------------------------------------------------------------------------