--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6051 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1237       1315   0    Initial     79    71        Good
aaagtagactcaccgtcttggtctagagactgacccctgcacagacagaccccttcccct
ctctgcgaaaggaccaagccccagaagtcactccatctcctacggctcgcaatttccaga
ggccccctggcaccttccagcctgatgtcgtgcgtcaagttatggtgagtagggagtggc
ATGTCGATCGCAGCCTCCGACATTCACACCCAGAGAGCCCCACAGACTCGCTCAGAGAAC
GTCTTTGAGTCCGGGGACG
gtgggggccggcgagggaggctggggattgcagtgagaacgccgagtcacaggggcgcgg
ggagcagcgctgaggcacggcacggccggctagtgggcgacacccctctctcaggcccag
cggtgcccccgcccccttggtgtccatcgaggaactggagaaccaggagctcgtcggcaa

Exon  2 +       1430       1570   2   Internal    141    94   Excellent
cctccgacattcacacccagagagccccacagactcgctcagagaacgtctttgagtccg
gggacggtgggggccggcgagggaggctggggattgcagtgagaacgccgagtcacaggg
gcgcggggagcagcgctgaggcacggcacggccggctagtgggcgacacccctctctcag
GCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACCAGGAGCTCGT
CGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGT
GGCGGTCAAGATCGTAAACTC
gtgagtgaccccggttgaccccagccgcaatctggccaaaaaggtggagccactgtgctc
tggggcctgaatggcgaagggagggattttcccacgaccccggtgcgactccagctctct
cctggagtgtaggaaggcgatatccagggaggtcaaggccatggcaagtctggataacga

Exon  3 +       1703       2012   2   Internal    310    79        Good
gcaacataggaagtggggctacgatgtggcggtcaagatcgtaaactcgtgagtgacccc
ggttgaccccagccgcaatctggccaaaaaggtggagccactgtgctctggggcctgaat
ggcgaagggagggattttcccacgaccccggtgcgactccagctctctcctggagtgtag
GAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCG
CCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGAC
TAAATTCATGGAGAACGGCTCCTTGTCGGGGCTGCTGCAGTCCCAGTGCCCTCGGCCCTG
GCCGCTCCTTTGCCGCCTGCTGAAAGAAGTGGTGCTTGGGATGTTTTACCTGCACGACCA
GAACCCGGTGCTCCTGCACCGGGACCTCAAGCCATCCAACGTCCTGCTGGACCCAGAGCT
GCACGTCAAG
gtcagctggtctacacccctctcagcctcaagacaaggccccagagctgctccagccagg
cccgccggacactagacctccagagccctgtctattgaataggcgtagcctctctctctg
gacacagggctgccaggggacaaagcccagccaggagttttagctcctgcctaccaggtg

Exon  4 +       2140       2294   1   Terminal    155    60    Marginal
accgggacctcaagccatccaacgtcctgctggacccagagctgcacgtcaaggtcagct
ggtctacacccctctcagcctcaagacaaggccccagagctgctccagccaggcccgccg
gacactagacctccagagccctgtctattgaataggcgtagcctctctctctggacacag
GGCTGCCAGGGGACAAAGCCCAGCCAGGAGTTTTAGCTCCTGCCTACCAGGTGATAGAGG
CCCTGAGCCACACGAGTCATTTCCACCAGCTGCCCCACCAGCCCCTCCAAAGAGTCATGG
CTGACCCAGCCCTGGAGACTCAGACCTTGACCTAG
ccctaccacaaggcacctagatctaccatccaagggaacctcttcccttgacctccacac
tccctttacaaagctgaacctgcaccttctgggggcaggggggttcctggaggctctctg
gcccccttgtcttccctacctcccacttctttccttcctttgcagctggcagattttggc

Exon  5 +       2460       2605   0   Internal    146   100   Excellent
cagaccttgacctagccctaccacaaggcacctagatctaccatccaagggaacctcttc
ccttgacctccacactccctttacaaagctgaacctgcaccttctgggggcaggggggtt
cctggaggctctctggcccccttgtcttccctacctcccacttctttccttcctttgcag
CTGGCAGATTTTGGCCTGTCCACATTTCAGGGAGGCTCACAGTCAGGGACAGGGTCCGGG
GAGCCAGGGGGCACCCTGGGCTACTTGGCCCCAGAACTGTTTGTTAACGTAAACCGGAAG
GCCTCCACAGCCAGTGACGTCTACAG
gtaaggatcccggcccaaacacacagccaggattcctacacttctctgggccctcccagg
ggatgatgtataggaaaggagtcttgccagtgattggaccgatcctcagctttgtgtctc
ctgcagcttcgggatcctaatgtgggcagtgcttgctggaagagaagttgagtgtaagac

Exon  6 +       2987       3053   2   Terminal     67    54    Marginal
ttaaccccaggtgcccttctcttgaaagccccaaggcttccccttcccgctcacctactt
agactgccctcctccctcctcgtgcccccacattacactccctgcctctttccatgatga
agcagataattcccttttaccctgaatgccttctcttctcaccctcctcccctactccag
TGCCAACCGAACCATCACTCGTGTACGAAGCAGTGTGCAACAGGCAGAACCGGCCTTCAT
TGGCTGA
gctgccccaagccgggcctgagactcccggcttagaaggactgaaggagctaatgcagct
ctgctggagcagtgagcccaaggacagaccctccttccagggtgagctggccagttagct
ggatctaggataagcttgggtctgtcagcagggggcttttctcaggaaaagaagatttgc

Exon  7 +       3265       3416   1   Terminal    152    99   Excellent
ttagaaggactgaaggagctaatgcagctctgctggagcagtgagcccaaggacagaccc
tccttccagggtgagctggccagttagctggatctaggataagcttgggtctgtcagcag
ggggcttttctcaggaaaagaagatttgctcacctgcactccactctgctgtccctctag
AATGCCTACCAAAAACTGATGAAGTCTTCCAGATGGTGGAGAACAATATGAATGCTGCTG
TCTCCACGGTGAGTGCCAACATCACCCCTCCCCAGGAGCTGGTCAGGGATGGCACAGCGT
GGCTACCTGGCCATCCAATGACTCACCACTGA
ccactgctttttatgccttgacctttgtacccaccgtccccagcccacccctgagttccc
agacaacagattatggaccgagagactactcccttgggtttactctggctcatccaagtc
atacccagcaaactcctcccatccctgcaggtaaaggatttcctgtctcagctcaggagc

--------------------------------------------------------------------------------