--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5681 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1266       1313   0    Initial     48    47    Marginal
tagtggcaactggctgggaatggctgaggggctacctactgcttgcggcctgccagcggg
aggaggggggcggaaagaagaaagggggcggggttgaggggggcgggcctggacctgggg
agtgaaagcgaaagcccgggcgactagccgggagaccagagatctagcgactgaagcagc
ATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAAGCCCGCAAACAG
gtaatggggaatcggaggccaggaaggggtcatagaaccctcttgggtggaggccaagct
gggtggttcaggggaccaagcagtgccagagaactcccccaatctcgctagtgccttcac
ttctcggggattcccagattcctgccttctgactgcagtgagcaggagcttccagggaaa

Exon  2 +       2358       2468   0   Internal    111    81        Good
tatcccctttgcccaccctctctagctaacaactggattcagcatgcagagaatagtttc
aaatagtggattaggaacattaggatggcgtgaggcatgagcctaggttgggaggcagag
tgcaagtgggatgtatggagggaaggctgtgacctaggatgaagggaagaggttgggcag
CCCTTGACAGTGAGCTCTGTGCAGGAGGACTCCCTCAATGTGGCTGACTTGACTTCCCTC
CGGGCCCCACTGGACATCCCCATCCCAGACCCTCCACCCAAGGATGATGAG
gtgaggcactcagggtgcaggacttggactataaacccaatggagaagatagcccttcaa
cctctgtgacttttctaaagctactttcccccctttttgccttagatggaaacagataag
caggagaagaaagaaggtaagagagataagaggtgactagggaaggggtgatggcacact

Exon  3 +       2574       2604   0   Internal     31   100   Excellent
aatgtggctgacttgacttccctccgggccccactggacatccccatcccagaccctcca
cccaaggatgatgaggtgaggcactcagggtgcaggacttggactataaacccaatggag
aagatagcccttcaacctctgtgacttttctaaagctactttcccccctttttgccttag
ATGGAAACAGATAAGCAGGAGAAGAAAGAAG
gtaagagagataagaggtgactagggaaggggtgatggcacactgactactggatgagaa
agggcctgaatcccctctttctcacagtccataagtgtggatttctccctgggaatgaga
aagtcctgtccctgcttgccctggttaagccagaagtctggactctcaaagagaaatgca

Exon  4 +       2658       2833   0    Initial    176    60    Marginal
tcagggtgcaggacttggactataaacccaatggagaagatagcccttcaacctctgtga
cttttctaaagctactttcccccctttttgccttagatggaaacagataagcaggagaag
aaagaaggtaagagagataagaggtgactagggaaggggtgatggcacactgactactgg
ATGAGAAAGGGCCTGAATCCCCTCTTTCTCACAGTCCATAAGTGTGGATTTCTCCCTGGG
AATGAGAAAGTCCTGTCCCTGCTTGCCCTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAG
AAATGCATTCTGGTAAGCCTGGGAAATGGGGGAAGCAGAAAGAGAAGACACACAAG
gtgaggccctggactcctccgtagatacaagtccttcatacagagacctagtcctgaaaa
agaaaacttccttctgtgccttgggcttagatcccctttgttctcctcgttctgttagac
ctctcttatcacaacggtacccccaaaattagagactgtgcagtatccactctgtaacct

Exon  5 +       3379       3447   0   Internal     69   100   Excellent
gggtacaataaatacatatctctgaaggttgctgtgatgattacatgaaataaatacatg
gcacagtacctggtatgtaataagtacccaattaaatataactttttttaggaagtgaca
gtaataggaagaactcagtatgtttgttgaatgattcttacatgatacctcttaacacag
GTGATTACATGGATCCAACACCTGATCCCCAAGATTGAAGATGGAAATGATTTTGGGGTA
GCAATCCAG
gtaagaaaagggtaactgaagatacttagagtggggagagcctcagggggtgagctagac
atgaaccaggaggaggaggaagatagtgtatgaaatggggaggacatgaagtgttgtctt
tgcctcccgtgtcaccacaggagaaggtgctggagagggtgaatgccgtcaagaccaaag

Exon  6 +       3588       3655   0   Internal     68   100   Excellent
caagattgaagatggaaatgattttggggtagcaatccaggtaagaaaagggtaactgaa
gatacttagagtggggagagcctcagggggtgagctagacatgaaccaggaggaggagga
agatagtgtatgaaatggggaggacatgaagtgttgtctttgcctcccgtgtcaccacag
GAGAAGGTGCTGGAGAGGGTGAATGCCGTCAAGACCAAAGTGGAAGCTTTCCAGACAACC
ATTTCCAA
gtgagggcagctggaggaccagcattgggggcagtaggagcatttctttgggacccccag
agctgggcagccctatcaggatgatgggagactttgggaagggtctgagggagtacatct
ccctgaacactcattcctgtggtattcccttgcttctggcaggtacttctcagaacgtgg

Exon  7 +       3818       3884   2   Terminal     67    64    Marginal
ccagacaaccatttccaagtgagggcagctggaggaccagcattgggggcagtaggagca
tttctttgggacccccagagctgggcagccctatcaggatgatgggagactttgggaagg
gtctgagggagtacatctccctgaacactcattcctgtggtattcccttgcttctggcag
GTACTTCTCAGAACGTGGGGATGCTGTGGCCAAGGCCTCCAAGGAGACTCATGTAGTGAG
TGGATAG
tccaccagccttttagctgggtgtgggacgaggaggtgtggaggaagaagtcctccttgt
cttgtttgtgactttcccaatgtggagaatattaagctaaaagcattacctagaaaaact
ggtttgggcttcaacaaccttgacccttttctctgctcagtcctttgggatcctatttct

Exon  8 +       4176       4262   0   Internal     87   100   Excellent
agaaaaactggtttgggcttcaacaaccttgacccttttctctgctcagtcctttgggat
cctatttcttggtgctaagaaggggttcattctcaagttaacctatttcctataaaagga
aaccagactcatgtcccagcctcccatgggactgactcagctttgcctcccacattgcag
ATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAGGCAGCCTATGGGGAGCTCAGGGCC
ATGGTGCTGGACCTGAGGGCCTTCTAT
gtgagtgtggagtaaggctttaggggaggtggatgagtgggggcaggcaggggattggct
aagaacctgactcttgcactctggccttctcccaggctgagctttatcatatcatcagca
gcaacctggagaaaattgtcaacccaaagggtgaagaaaagccatctatgtactgaaccc

Exon  9 +       4358       4438   0   Terminal     81    88        Good
ggattaccgggccttggtgcatgagcgagatgaggcagcctatggggagctcagggccat
ggtgctggacctgagggccttctatgtgagtgtggagtaaggctttaggggaggtggatg
agtgggggcaggcaggggattggctaagaacctgactcttgcactctggccttctcccag
GCTGAGCTTTATCATATCATCAGCAGCAACCTGGAGAAAATTGTCAACCCAAAGGGTGAA
GAAAAGCCATCTATGTACTGA
acccgggactagaaggaaaataaatgatctatatgttgtgtggattcccttctggcgtgt
gtcattcattcaaaaagcatttattgagtggcacctatgtccagcctgaagatgaatgtg
gtgggaaggggtgggtgtcacaaagacaaagatgacttagatgcccactgtaatcttgac

--------------------------------------------------------------------------------