--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (29533 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6740       6844   0     Single    105    40        Poor
aaatagggacagagtttcaaaatgttggcctggctggtcttgaactcctggcctcaggca
agcctttcacttgggccttccaaagtcctgaggttacattctgacctgtactgcttgagt
tcaactaagtttgcaaaccttttggggaaattcatttaaataggcagtagtgaagaggaa
ATGTATTCTAGCATCCAGGATAACCTCAAAGACATGGAATCAAAAATGAACATGAGGTTT
TTGAAGGTTGACAGTGAGGTAACCAGTAGAGTACAGAATTTATAA
caggaaattgaatatgctcagggggttctgccagacccttaggagtttaaacttgcaagg
ggagccatggaagacacctaaagtgttggggaaggagtgtcagaaattcttagaaaattt
gttgtgtgcatctgttgttcatttttctgggaggaaatgccatagtttcatcagatttta

Exon  2 +       7276       7353   0    Initial     78    66    Marginal
aaatgaaacacagctaggaattaggctggtcttagattaaacggattagagaagtagaaa
agatggtgtagtaatctaggcctgaaattataaggatcccaatgctggtataattattgt
aaagaagtggacatgaaggaaattttgaagaaaaaaattaatagtaaatagaagctcaac
ATGGAGGATGTAGAGCTTGGTGATGCTATTATCCAAAACAGAGAAGTTGTGCCGGTAGTC
CCAGCTACTGAGGCTGAG
gtgagaggattacttgagcctcagacttcaattcaatcttgggcagcatggcaagactcc
atttctttaaaattaaaaaaaagaagaaagagaaagttgagataattttaccagaaaact
gtacaatcaagcattgcttattttgtctctattgtttccgatcagaactacctttatcaa

Exon  3 +       8445       8568   2   Internal    124   100   Excellent
tatttatatggatttaatgtatttattacactttagtgtgttttctcttcctggttttca
aatgttttaaggtatttggcatgccttaaatgttacttattttgtttttttgttaaactt
aagtttatgaagtttcttttattttcagttaaaaaactgattttcttctccttgtttcag
TACAGCTATTGGAATCAGATGCAAAGATGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCT
TTCTAAACTTTATGAAGAAGGTTCCAACAAAAGACTTTTTAATGTTGATCGGCATGTTGG
AATG
gtaaggtcatgtttaaaatgttcctttttgtcttgtccaatttcttttgaagtaactgat
tggaatagatcactgtgcagtcacaaaagtaatcagagcaagttactgcatttgtccagt
tcactgtccagtagaaaggcagcattctcataaccttattagtgatgggggaaaaaccaa

Exon  4 +      14071      14172   0   Internal    102   100   Excellent
ttctaaattataatttcatactcaagcatcaaaatgccttgtagagagacctttaagcca
aaaaagtttattttgaatggtaatacttgttaaaaaaatgtttaataagtctttattaat
tgcagactttgatttgtgataggaatgtgttcctctagtaaattggtgcttttttttcag
GCAGTAGCAGGTTTGTTGGCAGATGCTCGTTCTTTAGCAGACATAGCAAGAGAAGAAGCT
TCCAACTTCAGATCTAACTTTGGCTACAACATTCCACTAAAA
gtaagttgataacatattgaggaaccttttggacagtaatagaagtttattaataagctc
ttctgcttccctccatagcatcttgcagacagagtggccatgtatgtgcatgcatataca
ctctacagtgctgttagaccttttggctgcaggtaagaaattttgtgaattattcaaaag

Exon  5 +      14251      14324   0   Internal     74   100   Excellent
gcagtagcaggtttgttggcagatgctcgttctttagcagacatagcaagagaagaagct
tccaacttcagatctaactttggctacaacattccactaaaagtaagttgataacatatt
gaggaaccttttggacagtaatagaagtttattaataagctcttctgcttccctccatag
CATCTTGCAGACAGAGTGGCCATGTATGTGCATGCATATACACTCTACAGTGCTGTTAGA
CCTTTTGGCTGCAG
gtaagaaattttgtgaattattcaaaaggcagatctgtactatagatatttattatgttc
cccagcatcttagccttttacatacttaaaaatagaaactcgtcgataagtattagggca
atgattaaataaaacagtgtacatagaaactacttgaggctgggtgccatggctcaagcc

Exon  6 +      20031      20096   0   Internal     66    87        Good
tggtattttagtatttttgagccctttggcattcatcagaatgtgtttgactatattttt
ctatacttgcttttaaaagtcatttagcatcctttcactaggttatagaaacattagtag
tcattaattacatatgatagtgtactaattcagtgattatatatatttttttctaaatag
GGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGCAAGCTGCAAAGACGGAAATAGAGAAG
CTTCAG
gtaataattaatgcttgaatttttactatgtcgtcatcctaatgcagtgaaattttatca
ccacagacatttcagtctaaggcagggatgtccaatcatttggcttccctgggccacaca
taaaatacaccaacactaatgatagctgatgagcttaaaaaaaaatctcatcatgtgtta

Exon  7 +      23800      23846   0   Internal     47    86        Good
acccagcctggagtataaatttcaaaacattaaaatatgaatcaggaaacttcgattctg
gtctttttcagactttaggttattttccttggttttatatctgagtataaaagtgaaaat
agttattacacaagtggaaaatgttcttctgatgaacagtatacattttattttctatag
ATGAAAGAAATGACCTGCCGTGATATCGTTAAAGAAGTTGCAAAAAT
gtaagttgaaatttttcttaccatccacaaaaatatttcatttgacctttgcatatatat
attacattaatcctaagaagctgttttcctgtaaaataacttagtgtataatttttagaa
ggtaaatttaacattctaagaagcctcacgaaggaagaaaatgtttttaagcaatatttt

Exon  8 +      26744      26811   2   Internal     68   100   Excellent
tatttcagtccctgtgtaatttgtcttctctaatgttaaatactatgtagaatgtgtctg
tgtaattttatagatacttttattatggatggacattctaatttgtactgactttgggtc
tgtgaactacttcaatgtttggaggttaccaaaatcttacctttcccttttctattctag
AATTTACATAGTACATGACGAAGTTAAGGATAAAGCTTTTGAACTAGAACTCAGCTGGGT
TGGTGAAT
gtaagttatttttgtacatttatttgccttaggaatgatctgtaccacagctaatttaca
actgagtgtcctttctaatataatgaaagctaaagcaaatttactaggttgtctaatgaa
gggaaagttctgcttaataattgacttaagttgtgaacacgttattttttgaaacatcca

Exon  9 +      28177      28221   0   Terminal     45    95   Excellent
atgttagagcaacatttgcttaattaactttgcttgggtatcttattctgaaactgttca
ttcagttacaagtagaggaatttaaccacttaattcaggttgttgtagcttaacttgccc
acaggtgtgggatataacaattttaaaaatcaattttaaacacctgttttctcttaacag
GAATCTCTGAAGGAAGAAGATGAATCAGATGATGATAATATGTAA
catttactccagcatctattgtattttaaatttctactccagtccaatgtaactatttag
ccctggattatacatactgtccaattttcattaaatttttgtcttataactattgaagtt
tggttaatatctgctttacaaaattggtgggggtaaatgaggacatttactcagtattaa

--------------------------------------------------------------------------------