--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (50000 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4338       4471   2   Internal    134    86        Good
tcggggctgcgtgtacaccatcttcgcagggagtggggtttgtatctgcaggcaggtaga
agagccagggctccgggcgcggacgccgtaggggtagcttccgagtccctacttggccaa
gggccggcacggaggggctgtcgatctactgggcacctaatagccgcacattctgtccag
TCCCTGGCGCCGGAACGTGAAGGCCCGGGTCCTGGCTGCTATCCGGGATCCGGACGCTCC
CTTCGGCTTCGGCCTGGTGCTCCAGGCCGTAAGGCAAAGGCGGCGGCAGCAGCAGCGGCA
GAGAAAGAAGCTGG
gtaaggcagtgacgtcatctgtggcggcccctcccccgcccgccagccctcaccgcagtt
cctgcccaacgacatccgggtctctgtagctgcgcgccgcgccgcagctgtagcggcggc
ggagccagcggggcggggcgagcggaggggtgggggaggggcgacgcggtcgtgagcgcg

Exon  2 +       4530       4620   0   Internal     91    53    Marginal
gaacgtgaaggcccgggtcctggctgctatccgggatccggacgctcccttcggcttcgg
cctggtgctccaggccgtaaggcaaaggcggcggcagcagcagcggcagagaaagaagct
gggtaaggcagtgacgtcatctgtggcggcccctcccccgcccgccagccctcaccgcag
TTCCTGCCCAACGACATCCGGGTCTCTGTAGCTGCGCGCCGCGCCGCAGCTGTAGCGGCG
GCGGAGCCAGCGGGGCGGGGCGAGCGGAGGG
gtgggggaggggcgacgcggtcgtgagcgcgcctgcgcggggccgcgctagaggcggcgg
cggcggcggtggcggcgctagggacgggagcgcgcgcgggagctagagagcagtggtctc
ggcgctcgtccggcccgcagcttcgggtcctcaggcggctgttgctccggaacgggtggt

Exon  3 +       9939       9991   0    Initial     53    47    Marginal
ttatttggctctgcaaagctggcaagatgtcaagggtttggagttaatgattaggtggga
gtagatggttaaattgcggataaagagtaacagtaataaagcaaaggtgaatgttcaggc
tagaatgatcagtcagtaaggaaggacaagggttggtattttgaagaggagttacagttt
ATGGTTAGAAATGAGCAGGAAGATATCATTGCTACAGGAAAGGATGCAAAAGA
gtaaggaaactaaatcattctgattaactcagttattaccattttttaaaaatggagtct
ttataaaaggcgttaaggctttatatgtgagttctaggttaagtctgaaaaattgtcttg
gaatagtgtgggtcttactactgcagacccaaaccaagatattagcattccaactggtct

Exon  4 +      12187      12315   0    Initial    129    66    Marginal
ttgatactttgtgttcctcttatgttttcctagccttgacgttagcaactaacaatgata
actaacattattgagctcttatgtgccagggactattacaatagattttcaattattatc
tcattaaatcttcatagcagccctatgagctagatactgttactacctatatcttaacag
ATGAGGAAATTTGAAACAGAGCAGTTATTTGCCAAGAGTTTCAGAGCTATTAACAGAAGC
CTAATACATGTTCTTGGACTTTGCAGAAATAATTTGTTGATCCATGCGGTTTCATTGCTA
CTGCGGAAA
gtaagtctcttggccattgtgatgggtcaaaatctttgtacatgaagggtatgactgttg
ttccattgtatccagagagtgaatcttgtgattgagttgggatttgaggtggcagtgtat
actaagtttgaaaagtatattatcatatgttagctccctttagaaattttccccaagaag

Exon  5 +      14187      14225   0   Terminal     39    83        Good
tctgaaaatcaagttttgattaagccgtagatttcttttagggtccaatattttcttttt
agaaatccactatgatatttttgtagggataaaagacaaccatgtattctatagatggaa
aatggtaggatacagtttgttggccggccaacttctctgaaaatactttttcctgcatag
AAGATAATCAGTGTTGACAAGGGAGAAGCCAAGGTATAA
tggctgttattcatctgtctcatgtattcgtcaagtgtcatgtgttaaatatgaacaaaa
aagacataatctctttcctcctggatcttaaaatctaaagtgagagataattcaccagat
aaatgctgcgataagggaaatagaggattctatgagcttatgactaaggatagatctgtt

Exon  6 +      37552      37624   0    Initial     73    94   Excellent
atgtatacagtacacttcgttatgtatatatataattgcttgcaacttgaaatttgaggc
tacaacatttacagtaatttaataacttaactgactttatcaaaaactgaaaaacctcat
ggaaaaggtagaatgtaaggtagacttaaaaggataggtatacttttttctataaatagg
ATGAGGCAAGAGTTTCCAGTTAAGGAAACTGACATGAGCAAAGGCTTGAAGGAGCATGCA
AATTTGGAGCATT
gtgagtagattattttttagtttttcagagttcatgcagtgggaataaaactagggagtt
tggaatcaagcttgaaaattcctgaatgttcaaccaagatatatttgagttagtagattt
tttgggtatgtcatgaattcgtttggcttttcttaattgatatacatacaacttagtcct

Exon  7 +      38133      38539   1   Internal    407    71        Good
tcaggctttcccccagttcctccttgttaatctccagattccaagtcagcaacacaatga
atgtctgcttatcgcgagttgtgaattcccgcatatctctttcacttattaaaaagattg
tttggtacatattttgtttataagacagttattgactttcctgtttctcttcctttgcag
ACCTAGAGGATCAAGACATAATGGGAGCATTTTTAGACAAGCCAAAGATGGAAAAGCATA
ATGCCCAGGGGCAGGGTAATGGGTTGCGATATGGGCTAAGCAGCATGCAAGGCTGGCGTG
TTGAAATGGAGGATGCACATACGGCTGTGATCGGTTTGCCAAGTGGACTTGAATCGTGGT
CATTCTTTGCTGTGTATGATGGGCATGCTGGTTCTCAGGTTGCCAAATACTGCTGTGAGC
ATTTGTTAGATCACATCACCAATAACCAGGATTTTAAAGGGTCTGCAGGAGCACCTTCTG
TGGAAAATGTAAAGAATGGAATCAGAACAGGTTTTCTGGAGATTGATGAACACATGAGAG
TTATGTCAGAGAAGAAACATGGTGCAGATAGAAGTGGGTCAACAGCT
gtaggtgtcttaatttctccccaacatacttatttcattaactgtggagactcaagaggt
ttactttgtaggaacaggaaagttcatttcttcacacaagatcacaaaccaagtaatccg
ctggagaaagaacgaattcagaatgcaggtggctctgtaatgattcagcgtgtgaatggc

Exon  8 +      41073      41190   0   Internal    118    85        Good
gggagggggagtcattgcacacacacacgcacgcatgcgtgcacatatgtatttttttct
ccctgaaagtaacattttcactagaacaagtataactgtaattggcacagctgtaaaggt
tctcaaggctttgaagagcaaaaagaaaactaaaatattctcaaatttttttcttcccag
GGAAGTCGAGACAACATGAGTGTGATTTTGATCTGTTTTCCAAATGCACCCAAAGTATCG
CCAGAAGCAGTGAAGAAGGAGGCAGAGTTGGACAAGTACCTGGAATGCAGAGTAGAAG
gtggatcatttaacaaaaaataagtagctttattaaagaaaaatcttcaacacaatcaaa
ctttaacattttagcttttagatttttatgtgtctttgacagctagtgtctagtgtatga
aagtggaaaaggacatttctgtagtagctgttaagatgtatgcagttgtcctatcacagt

Exon  9 +      46846      46903   2   Internal     58   100   Excellent
ctttaacataggagcccaaatatcttaaaagtgaggctcactattgacagcaagaaatag
aactaaaataatatctgagtataagattatcttagaaattttaataaacacctggctatg
agttactaagcaatgttttgctttctgaagaattaattttctgcatttttttacacttag
GAGGAATGTTATTGAAGCCGTTTACAATAGACTGAATCCTTACAAAAATGACGACACT
gtaagtagcattttagctccctctgctttcccttcccctccactctaaatgcatatcctt
cctacctgtttttgcagagctgttcactgtacccattctcttacacacacccctgattga
ttgctctgaactctgcttgctctgatctctgcctgcaccacagttctagtgattgaggac

Exon 10 +      47067      47092   1   Internal     26    87        Good
acaaaaatgacgacactgtaagtagcattttagctccctctgctttcccttcccctccac
tctaaatgcatatccttcctacctgtttttgcagagctgttcactgtacccattctctta
cacacacccctgattgattgctctgaactctgcttgctctgatctctgcctgcaccacag
TTCTAGTGATTGAGGACATAATCATG
gtgagtggccacctctctcaaaaaagaagaaagtccttttgaattattctagatttttta
agtctttacaaacaatcaacttcagaaggtttgcctccactacatggttttttttttttt
tttttcccgaagttgggactatctctactcagaatattgtcttattctgagttttgtaag

--------------------------------------------------------------------------------