--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5627 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1295       1521   0    Initial    227    82        Good
tccccgagcctgaccccgccccagagaaatccccagccagcgtttatagggcgccgcggc
ggcgctgcagagcccacagcagtccgtgccgccgtcccgcccgccagcgccccagcgagg
aagcagcgcgcagcccgcggcccagcgcacccgcagcagcgcccgcagctcgtccgcgcc
ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTG
AAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGAAAGACGAG
GAGTACGAGCAGATGGTCAAGGAGCTGCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCG
CGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAGGACGGGGACTC
gtaagtggcggaggcccggggctgggggtcgtcgggagggcgggacgcgcgcggcctggg
ggtgggaggcgccgggcctggagcccgagccgggggaccagcgatgcagccgggcgggcg
ccgcggcaccccggggctcctgcaccgccccgaacgctgcagggctgcagggccgcgcgg

Exon  2 +       2141       2249   2   Internal    109   100   Excellent
gggggcggaaagtccctgggcgcctgccaggaacactcagctcataataacctcgcggaa
aacaccgcggcctcggcctccagaaaccccggccttgcgcaatcccccgcagcccgcgcc
tccctgggccccacgcggtgcactcaccacccctggggtttttccctctcttccccacag
GTTCCTGCACTTGGCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCA
GGTGAAGGGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAG
gtgcgccgcttgcctggcccgggttctctctgaccctgggacgtagctgatgtagcagag
tcaccccagatcctttctgaattcagggccactgagcactatttaccctcaccttttact
tcacatcagcccacatcctagagagtgaaggaaattccactgatttggtgaggtctttat

Exon  3 +       2579       2789   0   Internal    211    96   Excellent
ggaaattccactgatttggtgaggtctttatgacccacctggagcctctgctatttgcca
gccctccccacccccctgtctaggaggagcagcacccaaccaggagacacgggttgaggg
gaactcggggtgtgggtttggtccatggcttactttctctggtctctcttgcattcgtag
ACTCCACTCCACTTGGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGA
GCTGGCTGTGATCCTGAGCTCCGAGACTTTCGAGGAAATACCCCCCTACACCTTGCCTGT
GAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGACTCAGTCCTGCACCACCCCGCACCTC
CACTCCATCCTGAAGGCTACCAACTACAATG
gtatgtctgcctccctgccctgccccaccccctcggagggcaggtgacgtggagaagggg
caggtgggccaacttaaggagtccaggcaagagcttaaactcctaacatttggaaggttg
agaaaatatgtgtgcaaagtgcctattggatgcctttataaagttctttcagaacccaga

Exon  4 +       3080       3168   1   Internal     89    89        Good
tggaaggttgagaaaatatgtgtgcaaagtgcctattggatgcctttataaagttctttc
agaacccagactgtgggttcttaaaattcagaagataagactacttgttccataaaagaa
taggtgaaaggagtgagggttgaaacaggtggttatacttttttccttttgttcttccag
GCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGG
TGTCCTTGGGTGCTGATGTCAATGCTCAG
gttggtgcttcctgcccccgacgcactgagtcaggctcctcgtgcttatgttgtgagcag
aaattccaaatgcagccataagcatctcaaattccttttggtttcaggagccctgtaatg
gccggactgcccttcacctcgcagtggacctgcaaaatcctgacctggtgtcactcctgt

Exon  5 +       3276       3545   0   Internal    270    99   Excellent
cttagcctctatccatggctacctgggcatcgtggagcttttggtgtccttgggtgctga
tgtcaatgctcaggttggtgcttcctgcccccgacgcactgagtcaggctcctcgtgctt
atgttgtgagcagaaattccaaatgcagccataagcatctcaaattccttttggtttcag
GAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTG
GTGTCACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGAGTTACCTACCAGGGCTATTCT
CCCTACCAGCTCACCTGGGGCCGCCCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTG
ACACTAGAAAACCTTCAGATGCTGCCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAG
TCAGAGTTCACGGAGTTCACAGAGGACGAG
gtgagtctgtgaactccttcggcgctctaactaatgaggtgccattcccttcaccctccc
aggcccctagagctgctccttatcagaggggtatctacataatgagtctctcaaatttct
gtgcataaccagtatcccaagaatgtacctgccccccctctttttttaaagagaagcatt

Exon  6 +       4117       4266   0   Terminal    150    76        Good
gctgaaagaacatggacttgtatatttgtacaaaaaaaaagttttatttttctaaaaaaa
gaaaaaagaagaaaaaatttaaagggtgtacttatatccacactgcacactgcctggccc
aaaacgtcttattgtggtaggatcagccctcattttgttgcttttgtgaactttttgtag
GGGACGAGAAAGATCATTGAAATTCTGAGAAAACTTCTTTTAAACCTCACCTTTGTGGGG
TTTTTGGAGAAGGTTATCAAAAATTTCATGGAAGGACCACATTTTATATTTATTGTGCTT
CGAGTGACTGACCCCAGTGGTATCCTGTGA
catgtaacagccaggagtgttaagcgttcagtgatgtggggtgaaaagttactacctgtc
aaggtttgtgttaccctcctgtaaatggtgtacataatgtattgttggtaattattttgg
tacttttatgatgtatatttattaaacagatttttacaaatgagttatcctgatcatttt

Exon  7 +       4453       4524   1   Internal     72    71        Good
acagccaggagtgttaagcgttcagtgatgtggggtgaaaagttactacctgtcaaggtt
tgtgttaccctcctgtaaatggtgtacataatgtattgttggtaattattttggtacttt
tatgatgtatatttattaaacagatttttacaaatgagttatcctgatcattttcttcag
GCTGCCGTGGGCCTCCGGTTCTGAAGTTCCATCCTCCGGCAGAGGTGGAGGTGGAGCAGT
GTGAGGGAGGAG
gtaactcccagcagcttctcacacctgacacccagcctccagcaaagctttgcaggcacc
ctgggcccagtgtgtgggagggaggctgttgcaaggttataggaaattaccaatctcagg
cttggggtggaagcatgctgtttggcctgtggttggagacctctccgttgtcattctgtc

--------------------------------------------------------------------------------