--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (43756 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1157       1314   1   Internal    158    84        Good
atatatgcagattttggtatttttctgaaaacttaaattgttactggttcaaagaaatgt
tctctgaaaatgcatgttgaattaatactgaaacagttaatttttggataccttttcttc
ttctactagaaatagaagacttgttttcttcacttaaacatatccaacatactttggtag
ATTCTCAGAGCCAGGAGGATATTTCACTGCTTTTACAACTTGTTCAAAATAAGGATTTCC
AGAATGCATTTAAGATACACAATGCCATCACAGTACACATGAACAAGGCCAGTCCTCCAT
TTCCTCTTATCTCCAACGCACAAGATCTTGCTCAAGAG
gtatgtattctaaacatcttgttgatgtctacaaggtaattagtagtggcaggaaggcag
gattattggaaaatactaatgtgactataagatttgtttgaattaattactgttaattac
atgttaataatgtattgtgacagtttactacatgcattttatcctaaaaacaaaaaaagt

Exon  2 +       6606       6705   0    Initial    100    47    Marginal
tgaagctgaataagatacaattctatcttcattgagctcagtctagtggggaaatagccc
tattgataattttagatcaaatgttcagtcttatgagtacatattatctaggcaaataga
ataaggcaattcaggtagctgagacagctagtataatcacagttgttgtggggagacagc
ATGGTTTGTGCAGGGAACAAGCAGTTTAATGCTGAATCAAAAAGGTTAAGGCATAAGGAA
TGCCAGGAGATAGGGCTGGAAAAGACGAAAGAATCAGATG
gtgatggtccttagatttaatactaaggagcttagacttaatcttgtgacagagagccac
tcagaactagaatggtcatatttctgttttaaaaaggatatttagtgacatagaaaaata
aaatattttagtaatttattagtatcaagtcaaaatagttatactgttactaggggccgg

Exon  3 +      10567      10713   0   Internal    147    86        Good
tttcataacccattccagagtatgcccttagtatacttaacacatctttattattagctc
taattaattataacacttttaaagatttaatggtcagaatactatgtacataggttaaaa
atcactctgcagaaataaatcatgctgttacttaaaatgccatggatttctttgaaacag
GCACTTTTACTGGCCCACGATAAGGTTGCTGAGCAGGAAATGCAGCTAGAGCCCATTACA
GATGAGAGAGTTTATGAAAGTATTGGCCAGTATGGAGGAGAAACTGTAAAAATAGTTCGT
ATAGAAAAGGCTCGTGATATTCCGTTG
gtaagtgtcccacatactgtttttaaacaagtgcatttttctgctgttgtgtgcttcaaa
agtctggttaatttcagaattctaatgaatagagtatttctgaagcagaaagtgtggggg
aaatggtcaacttttaaatctaattacaattactctagttgtgtaaataaattttttctt

Exon  4 +      11005      11166   0   Internal    162   100   Excellent
gtgtgggggaaatggtcaacttttaaatctaattacaattactctagttgtgtaaataaa
ttttttcttaagataactgaaggttagtattgttgaatggaaaaaatagaatttaaaaat
aaatgcttaacaaaaattgtattatttttatttttaaattatacatatatatatttttag
GGTGCTACAGTTCGTAATGAAATGGACTCTGTCATCATTAGCCGGATAGTAAAAGGGGGT
GCTGCAGAGAAAAGTGGTCTGTTGCATGAAGGAGATGAAGTTCTAGAGATTAATGGCATT
GAAATTCGGGGGAAAGATGTCAATGAGGTTTTTGACTTGTTG
gtaagttgacgcagctagaagaataattgatagcttttagaaagctcttattagacttta
gaataaaatatttttaaaataactgttaagagcactagatgatttctagcctgatttttc
catgatgtaactgttccacagtatttgttagcagttttatttttgggtggtaccactgat

Exon  5 +      16526      16631   1   Internal    106    50    Marginal
gataaatctgcgatagtaagagatacagaaataaaaattacaaagaaaaatattttggta
gcagagatgtggaatcaacctaaatgcccatcgatgatagattcgataaagaaaatgtgg
tatatatacaccatggaatacgaatgcagccataaaaaaatgagatcatatcctttgcag
GGACATGGATGGAGTTGGAGGCCATTGTCCTTAGCAAACTAACACAGGAACAGAAAACCA
AAAACCACATGTTCTCTTACATGTGGGAGCTAAATGATGAGAACAC
gtggacacataaaggggaacaacacacactagggtctttcagagggtagagggcaggggg
agggagaggatcaggaaaagtaactaatgggtactaggcttaatacctgggtgatgaaat
aatctgtacaacaaacccccaacacacaagtttacctatgtaacaaacctgcagttggat

Exon  6 +      21122      21352   0   Terminal    231   100   Excellent
ggagaaggatcgcttgaggctagaaatttgagattatcctggacaacatactgagatgct
gtctctattaaatttttttaaaattaaaaaataataaaaaatttgtagcatttaaattgt
attcatatgaaacattttatattgccatttattgttgtttttgccctttttatcttttag
ATCCATGTAAAAGCTCATTTTGACTATGACCCCTCAGATGACCCTTATGTTCCATGTCGA
GAGTTAGGTCTGTCTTTTCAAAAAGGTGATATACTTCATGTGATCAGTCAAGAAGATCCA
AACTGGTGGCAGGCCTACAGGGAAGGGGACGAAGATAATCAACCTCTAGCCGGGCTTGTT
CCAGGTAAGACACAATATGGTAGAAAGTACATAATATTAAAAGAACATTGA
aaatgcaagccttcacaaagaaaaactcactctttcatgcctctatttaataaagtattc
cagttactttttcgtgtagttgggtttttatgttgtacctgcagcgtaagtatattaaat
agaatgtggccaattctttggcctttagaatggaattatgtataacttcagccaatccca

Exon  7 +      25948      26074   0    Initial    127    88        Good
taaaaacaagctgggtgtggtggtttgcacctgtaatcccagcactttgggagactgagg
cgggaggatcacttgaggccaggagttcaagacaagcgtggccaacatatggagatctcg
tttctgcaaaaaaatttaaagaataaatgaatgaataaatagagttcttcaatttgagtt
ATGTGGTTTTGTTCACGGGAACACATTTATAGTTATGTTTATGATTGCTCAACAGGAAAA
CTGTGGTGTGCAAAGAAGAATAAAAAGAAGAGGAAAAAGGTTTTATATAATGCCAATAAA
AATGATG
gtaagttctactctcagggataggtggaattatatctgaaaggagtctaaacctagtcct
gttttgcaccttaatgttaaatatgtgcttgagaaaatcatttagtagaaagtattttct
tttggaatcctgtgagtaaggcagtgttttgaattctggggaaaactgatacaaaaattc

Exon  8 +      28825      28992   1   Internal    168   100   Excellent
ataaaaattaatagaaggagtattatattgttgtctgattcattttcatgataccctagc
aaggatgtaatgacaataaattgtgcttttgtctaattttgggtgaagatctatgagtat
ttatatctttaatacatggccataattttgtttgaagagcttaacttttttttcccaaag
ATTATGACAACGAGGAGATCTTAACCTATGAGGAAATGTCACTTTATCATCAGCCAGCAA
ATAGGAAGAGACCTATCATCTTGATTGGTCCACAGAACTGTGGCCAGAATGAATTGCGTC
AGAGGCTCATGAACAAAGAAAAGGACCGCTTTGCATCTGCAGTTCCTC
gtaagtttgaatgcattcccattttcctgtgcttttcaatttaccagctcagaacctaac
tatatcatgtagggaaattttttattcatttcattaaaacactgttgtcagtgaaagagg
aactttaaccaaagattttgacaatttttaaattaaaaatagtcattattaagaaattta

Exon  9 +      29652      29854   1   Internal    203    67    Marginal
gttcatttttcaatctacaaaaaataaaaacaatgttaaacatgtaggcacttagcattt
tctcagtttattattttataatctgtgttacaaaatagaaattctttctgactagcagaa
ttatcccctgtcctcactctaagccatgcctgttatttctatctgattttgtttgcctag
ATACAACCCGGAGTAGGCGAGACCAAGAAGTAGCCGGTAGAGATTACCACTTTGTTTCGC
GGCAAGCATTCGAGGCAGACATAGCAGCTGGAAAGTTCATTGAGCATGGTGAATTTGAGA
AGAATTTGTATGGAACTAGCATAGATTCTGTACGGCAAGTGATCAACTCTGGCAAAATAT
GTCTTTTAAGTCTTCGTACACAG
gtaaagctagaactttgttttagggtttgaacttagaaggaatgtcatatagagtaatct
agtggaagctatattttggtccaagaacagcgcgacctaattaagttctcatacggtttt
tcccactgatttgctatctgaaatcacacaggttgctaaatctctttcagtttcctcaga

Exon 10 +      41375      41551   0   Terminal    177   100   Excellent
agatgccaaagcaaaggtaaccattgtggccgtgacagggttggaaaggagctcctgagg
ttgggagagacagaaggaaagctatgaaggtcgctccttgttctttggccatctctgact
catcctatattatttggttaggaaaggaattatctcacagtttttatcttctgtttgcag
CCTGAAGAGTTGAGAGAAATCATTGAGAAGACAAGAGAGATGGAGCAGAACAATGGCCAC
TACTTTGATACGGCAATTGTGAATTCCGATCTTGATAAAGCCTATCAGGAATTGCTTAGG
TTAATTAACAAACTTGATACTGAACCTCAGTGGGTACCATCCACTTGGCTGAGGTGA
aagaaacatccattctgtggcatgttggacttgatctggcaaaaactgccaataggagga
ctgcccgacactgcagcaagattgaggataagatggaaggcagcagtataagctgtagat
ctgttcttagatctcttgaattagtgagacgacagttcccttaggcagtttgtgcatggc

--------------------------------------------------------------------------------