--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (29782 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1094       1219   0   Internal    126    75        Good
gcggactacgactcccaggaggcgccgcgccgcggctctccccgcccccccccgcccccc
cccccctccccgggacgcgcaggcgccttgggctccgtcaacaagccgggctggcgtcgc
ctggatgcggtttcttccgggatttgtagtttttctggagctacccgggccgtctgttag
AGGGACAAGAACTACAAGTCTCGGCTGCCCCAGCGCTGCGAGCCTGGTCACGTGGCGGGG
GCCGACCGGGCGTGCGTGCCGCCGTTGATCCGGTGCTGCAGTGAGGAGGTGGTTCTTGCC
CGTGTT
gtgtgtgtgtgtgagtgagagagcgagtgagtgagtgagtgagtgtgtgtgtggggggga
ctcggcttgttgttgtcggtgacttccccctccccttcaccccttcccctccccgccgcc
gctgcagtggccgctccctgggccgtaggaaatgagcgataacgatgacatcgaggtgga

Exon  2 +       1368       1406   0   Internal     39    98   Excellent
gctgcagtgaggaggtggttcttgcccgtgttgtgtgtgtgtgtgagtgagagagcgagt
gagtgagtgagtgagtgtgtgtgtgggggggactcggcttgttgttgtcggtgacttccc
cctccccttcaccccttcccctccccgccgccgctgcagtggccgctccctgggccgtag
GAAATGAGCGATAACGATGACATCGAGGTGGAGAGCGAC
gtgagtcctggggcttcttccttcccgtgcgggttgtcaggcggggacagcggccggggc
tcttagcggggcgacggcgggagggggccgggctgccgccgcctccttccccttcccctc
ggggccaggagtgcctccgtcgcgttcccggttcgctcccctccggctcctggccggagc

Exon  3 +       1878       1984   2   Internal    107    70        Good
ccgggggacaaggatggggggcgcccgggatcccattgtccggatccaggggaaggggac
ggcgttcaggacctgccccttcggactgcgatcctctcctcccgtgacccgcggatcctg
ggggccggggaagggcggagaggggttgggggtgcctagatgcccgagctgggtctgcag
GGAGGAGACAGTGCTCGGGACCCCTCTGGCCCAGGTCGGATCCCGGAAGGAGGGGCGGCG
CTCGGGACCCCTCTACCCTGCTACCGGATCCCGCCGAGGGTGGAAGG
gtgggggcaaggggtggggagggaggaaggggtgtcgggctgactccccaccctccgctt
cctctgccgccggcattttctttcttattattgaatgttaagtgtaaaaataacttctat
attttctatttttttttttctctcttattccaggaagagcaaccgaggtttcaatctgcg

Exon  4 +       5358       5469   0   Internal    112    62    Marginal
gggttagtgtgttggtcaggaaatgcaattttttttccagtgaccatccttgatggcacc
tgactgagttgcagttgcagtatacttgtgaggggtttgaaaacagatttgtgcaattcc
acttctggacctttctggcatgaaatatttttaacttctcagagctctttgcttctttag
GAATATTCAGAAGAGAACGAGCTTGGTAGCCTCCGAGATTGGAATTCACTCAGGAAACTA
CTGTCTGTTTTACCTGCAGTCAGTTGCATGGCAAAAGTGCTGCACAATGCAT
gtactttttctctgcttagagtgttgacagtgatgcttacagtgataacaaatgccagag
ttagttcctaaatgtgcctgtgttagggtaaaagttgttcttatgtctaaaagaattttt
ccaagatgccagtaacggtgaaatagttggtcaaagaattcagcttggtttttaattaaa

Exon  5 +       9729       9860   0   Terminal    132    45    Marginal
aaccacagactggtggctcttctgtcacataagcaagttgggggggaccactgatgttac
aggagagtcacactttgtccccctgaataacttttattttacttatgcatgagctggatg
catcgagctactttggatgttcctgtcgcaagcgttgctcacccctttctccccctttag
CAGAGCCTAATTCTGGAGACTCCTAACTGCCCACCTCGAGAAATCCTTCCCAGTCCACTC
GCCAGGGACAGTGCTGACAGCGTGTACTTCCAGGCTGTACCCCACCCACCTTGTACCAAG
CAAAAGGAGTGA
cattcctaatgtgttctttctcccattcttctaggctgacaaacgggctcatcataatgc
actggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagt
cccatcactccaaggagagaaggtgagtttcctgagaaagctgagtagctggccactact

Exon  6 +       9895      10002   0   Internal    108   100   Excellent
ttctccccctttagcagagcctaattctggagactcctaactgcccacctcgagaaatcc
ttcccagtccactcgccagggacagtgctgacagcgtgtacttccaggctgtaccccacc
caccttgtaccaagcaaaaggagtgacattcctaatgtgttctttctcccattcttctag
GCTGACAAACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGAC
AGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAG
gtgagtttcctgagaaagctgagtagctggccactactagcttggaacttgttgcagagc
ttagcagagcactcacctattgggaaggaaatgtagtcagagatattcaggtagcatggt
tgccttatttttgactgtttggaggatcactgcacaccttacgtactccagtttatcctt

Exon  7 +      16189      16239   0    Initial     51    58    Marginal
tcctttctgcctatgagcctgtaaaatcaaaagcaagttagttacttcctagatagagtg
ggggtacaggcattggataaacacagccattccaaatgggagaaatcggtcaaaaaaagg
ggctacaggcctcatgcaagtccaaaatccagcagggcagtcaaatctaaaagccctgta
ATGATCTCCTTTGACTCCATGTCTCACATAGAGGTCATGCTGATACAAAAG
gtgggttcctttggtcttgcatagctctacccttgtggctttgcaaggtacagcctcctt
cctggctgctttcacaggctggcattgagtgtctgcagcttttccaggtgcacagtgcaa
gatgtcagtcagtggatctaccattctggggtctgcaggatggtggcactcttctcacag

Exon  8 +      21693      21807   2   Internal    115    91   Excellent
tcccaaagtatgagtgtcctggaggcttggattcaaatcctgactcaacttcctattagt
ttacataacattgggtaaattacagctctgtgtctcggtttcctcatttataaaataggg
aaaacatcagaaggttgtgtgaggatgcctgacacttagtaagtactcagtaagtgttag
TGCTGCCATTGTTACCACCCCCATCATCATTGTCACTTGTGTTGCTATGTGCAGCCATGG
CTTTGGAGCAAGATCTCGCAAGGCTGCCCAGTATCCCTTTGTGTGGCTCCCAGAG
gtgagagagaggcctgctgagccctttgcgtttgcttacatggctacatgggaggcctgg
ctacctcttcagtcccttcagccaccatccaccctgtctcagggctccatccaagccatt
taaagagccatttctgttcacaaagacagactcaaaattatgattctgctaattataaaa

Exon  9 +      25674      25797   0   Internal    124   100   Excellent
aaaaataaaaaaataaataaataaataaagcctacagtagccattattgtatttcttcag
ccttttcccaccttaccctctcgtttccagccacccaagcagttgctgcaggccaggttc
cctcactgcctggattgggtttttattttgtcccctgtgctttttctcatattgccacag
GCATCCCGGGCCCAAATCCTAGACAAAGCCACAGAATATATCCAGTATATGCGAAGGAAA
AACCACACACACCAGCAAGATATTGACGACCTCAAGCGGCAGAATGCTCTTCTGGAGCAG
CAAG
gtgagcacccgagctcgtggggcagctggccctgctgtgctccagccaggtcaggctttg
gcacctgggcctgcagagtcagagccagtcatggagtatgtgctcagtagcaggcttggt
cctgcttcttggggcctgagtaactgagtgttagagccgtcctgaggaaggacctgaggc

Exon 10 +      27047      27234   1   Terminal    188    88        Good
cgggagggaaatgaagtgtgtgagtgaacagccacccgaagggagctacttctgagcatc
ttgagcctcgggggccaacaagcaagcccttaggaagaacaggctggaccctgagtctga
gactcggttactccccaagtctccagaaggcagtaacacactcccttggttgccttttag
TCCGTGCACTGGAGAAGGCGAGGTCAAGTGCCCAACTGCAGACCAACTACCCCTCCTCAG
ACAACAGCCTCTACACCAACGCCAAGGGCAGCACCATCTCTGCCTTCGATGGGGGCTCGG
ACTCCAGCTCGGAGTCTGAGCCTGAAGAGCCCCAAAGCAGGAAGAAGCTCCGGATGGAGG
CCAGCTAA
gccactcggggcaggccagcaataaaaactgtctgtctccatcgtctcatcctcctttca
gttcgttggtagagccctcagaaccatttaagagactctttatttttctctttctccctt
ttttttttaaatttttatttttacgtagaagctcttggacaacagctctcgttctccttc

--------------------------------------------------------------------------------