--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (109599 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (37 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2582       2721   0    Initial    140    79        Good
gcactcttacgtccaaacgtacttaggagtcttttttaattgctaggaggacactatgaa
aatttggttctagcagatgtaaaggaagaaaaatttaagcccaagctgttcagtcccgga
atttaaaggacttttctccctttacttttcaaatttaagcaaagagacttttaaaaaacc
ATGGCAGATGTGGACCCAGATACATTGCTGGAATGGCTACAGATGGGACAGGGAGATGAA
AGGGACATGCAACTAATAGCCCTTGAACAGCTATGCATGCTGCTTTTGATGTCTGACAAC
GTGGATCGTTGTTTTGAAAC
gtaagtacattccttcatcatgttcctttgggttactgtagtgacatctgttttcaacca
tttgctgacttcagtttgtgtagaaatttctctagtgaattttaacacgtatctttaaaa
atattcctgaagagttttgtgtttacacttttccaagaaataaaaattggtaggtgaaga

Exon  2 +       4465       4610   0    Initial    146    53    Marginal
atgctgctataaagacacatgcacacgtatgtttattgtgtcactattcacaatagcaaa
gacttggaaccaacccaaatgtcgatcgatgatagactggattaagcaaacgtggcacat
atacaccatggaatactatgcagccataaaaaatgatgagttcatgtcctttgtagggac
ATGGATGGAGCTGGAAACCATCATTCTCAGCAAGCTATCGCAAGGACAAAACACCAAATG
CATGTTCTCACTCATAGGTGGGAATTGAACAATGAGAACACTTGGACACAGGAAGGGGAA
CATCACACACCGGGGGCTGTTGTGGG
gtagggggaggggggagggatagcattaggagatatacctaatgtaaatgacaagttaat
gggtgcagcacaccaatatggcacatgtatacatatgtaacaaacctgcacgttgagcac
atgtaccctaaaacttaaagtataataaaaaaaaaaagtgttgccatgttaaaacaattt

Exon  3 +      27071      27170   1   Internal    100    58    Marginal
ttttttttcttttgagacagggtcttgctctgtcacccaggctggagtgcacaggtgcga
tcatggctcactgtagccttgatttcctggattcacatgagcttcctgcctcagcctccc
gagtagctgggaccacaggtgcacactaccagcctggcttggtttttcatttttttgtag
AGATGAAGTCTCCTTGTGATGCCCAGGCTGTTCTTGAAGTCCTGGACTCAAGCACTCAAG
ATGGGAGCATCTTGGCTTCCCAAAGTGATGGGATTACAGA
gtgatccactgcacccagcctaaactggctctttaactatacttgttcaggaaatgcatc
gcattttagggaacacagcaggaactattattccccaaattagcaaatactacattcccc
catgaaatgtattaagtttatactaagcattgctcttaaattttattttttttttgatgt

Exon  4 +      30264      30498   2   Internal    235    92   Excellent
tagcatgtgagtattgttatggaagcaaaaacaatgtgagaaatattacctaataaacat
tcagacacagtattgagcacagtgtgttacattataactttttattttctattattttgt
taatattttgctgttaagaatttaataaccctagatgtaatatgatttctttcactacag
ATGTCCTCCTCGCACTTTCTTACCAGCCCTTTGCAAAATTTTTCTTGATGAAAGTGCTCC
AGACAATGTATTAGAGGTGACAGCCCGTGCCATAACATACTACCTGGATGTATCTGCGGA
ATGTACCCGAAGGATTGTTGGGGTAGATGGAGCTATAAAAGCACTTTGTAATCGTTTGGT
TGTAGTTGAACTTAACAACAGGACTAGCAGAGACTTAGCCGAACAGTGTGTAAAG
gtaagtattacttattggctcattacttatttttctcagacctctcagggatgagtattg
gctcatttaaacatcacttagagactgaaaaatgtatttactaaaaaaaaaaaatttcta
aaaaaaaaaattcttcctatcttcagtcttactttattgagagtagttgagaacagtgga

Exon  5 +      33380      33607   0   Internal    228    51    Marginal
agtgctgggatcacaggtgtgagctaccacacccatctaaaatgtattattaaaattaat
ttcatttgtttcacttttctgtttttaatgtgtcactaataaatttggagagcgcattgt
ttctgtgattcttgaaaatcaggcttgcattctttcgttacatttgttttactattatag
GTATTAGAACTGATATGTACTCGTGAGTCAGGAGCAGTCTTTGAGGCTGGTGGTTTGAAT
TGTGTGCTTACCTTCATTCGTGACAGTGGACATCTAGTTCATAAAGACACCTTGCACTCT
GCTATGGCTGTGGTATCAAGACTCTGTGGCAAAATGGAGCCTCAAGATTCTTCTTTAGAA
ATTTGTGTAGAATCTCTGTCTAGTTTATTAAAGCATGAAGATCATCAG
gtaaataagttgctgttacatactttccattttcagaaagtgatttttttagtgttcccc
tgtttataattatgatagactgtaatttgtgcttttcacttgatgaaatcgaggtaattc
catcctctttctctaattttatctctgcatgtggtaatctccattttgggaatgaaactt

Exon  6 +      35092      35362   0   Internal    271    65    Marginal
agattccaaattgagtaatcaggtgtcaacaattgtaagtctgctctcaacactttgcag
aggctctccggtagtaacacatgtaagaatgtttttgaatctttgctttttaatcttcag
aaaaagtgtttttgtataatgctaatatattaaacatctttcttcccattctctttctag
GATCTTCTGAGGTCGGAGCTTCCAGATTCAATTGAAAGTGCATTGCAGGGTGATGAAAGA
TGTGTGCTTGATACTATGCGTTTGGTTGACCTTCTCTTGGTGCTATTATTTGAAGGACGA
AAAGCTTTGCCAAAGTCTAGTGCTGGATCTACAGGCAGAATCCCAGGACTCCGGAGATTA
GATAGTTCTGGGGAGCGCTCACATCGGCAGCTTATAGATTGTATTCGAAGTAAAGATACC
GATGCACTTATAGATGCAATTGACACAGGAG
gtcagaaaatatttttttaaatataaaaagaaagttgtgagataaccatataggcagttt
ctagttttcggacagtactcttagaaatccagataacaaagtggcaccccttcgatattc
tcccctatccctgtgcataattatgtaattatcagcttggttcttggtgaaacctgaata

Exon  7 +      36396      36472   1   Internal     77    75        Good
tgatctcaagtttgctgattatgtactgctctatagttgacctaaatatttaaaacactc
tcttggctctttatttagatgatgactaatgacgatcttaaaatggttcagtctttagaa
aagtttagtattttattggctttaaaaatacgtttctttttttttccttcaaaatttcag
CCTTTGAAGTAAATTTTATGGATGATGTAGGTCAGACTCTATTAAACTGGGCCTCTGCTT
TTGGAACTCAGGAAATG
gtaagctaataaataaaagctggtatttaaattaaggatagaaatattaataaaaagcag
ctttatgattcgttatcattttacaggtagaatttctttgtgagagaggtgcagatgtta
atagaggtcaaaggtcatcatcattacattatgctgcatgttttggaagacctcaagtag

Exon  8 +      39050      39164   0   Internal    115    78        Good
tcggcctcccaaagtgctgagattacagaataggctgcttttaaggtactaagtgcaaag
gcagagatatggattgccacctgcttgattaagtaattctggaaaatctttagtttacat
agttggatgtcaaagaaataaagtattgttatattcaaattaaatgcttttcttctctag
ACTCTGTTACGGCATGGTGCAAATCCAGATCTGAGAGATGAAGATGGGAAAACTCCATTA
GATAAAGCTCGAGAAAGGGGCCATAGTGAAGTGGTAGCTATTCTTCAGTCTCCAG
gtgagagctacattctttcttttgaagccatctactgttatttttcagctttcacttcca
tagctttctgtagacacattaaccttatataaatgaactattcctatgaagtcaaataat
tatatatgtatatccttatatttaataaacctgtttaacagcttaattttctatgttctt

Exon  9 +      40046      40224   1   Terminal    179    99   Excellent
acattgaagttactagtgctctttagtattcttataagcatcattgaaacaatgttctaa
tttcagtgtatttgttaattagagataattattatttgaagttggatatatcttaaggtt
tttttccttgaaagcaaaagtttccaaaaaagtatttctttaaaaaatatttgtctgtag
GTGATTGGATGTGTCCAGTTAATAAAGGAGATGATAAGAAAAAGAAAGATACAAACAAAG
ATGAAGAAGAATGTAATGAGCCCAAAGGAGATCCGGAAATGGCACCCATATACTTGAAAA
GGTTATTGCCAGTGTTTGCACAAACATTTCAGCAAACTATGCTGCCTTCAATAAGGTAG
ttattcatactatttgatgtgttagtcaaattacaccaattatatggttttatttatctc
ccttttccagaagtatttgaggtttattttaatgttaaaaaggtgtggtaagaataaaat
ttagatgagaagtgggaaagccctatcttttcttctgacgatctgaacgaagagaagttt

Exon 10 +      43887      43931   0    Initial     45    44    Marginal
ggttattttcttttatcattttaaatgtttggagatattagtgttagaaaatttgatgct
aaattttcccaggtagttattagcagacacatttaattgtagctaggaaaataatatatg
tcttagtttaagaactcatactctggaatcaactcattgcactttcctatatgtttggcc
ATGGGCAAAGCACATAACCTCTTAATCAATTGGCTCGTCTCCAAG
gtgaggatagttatacttaatcctctttaggagtgagaataaaaattaaatatgtgtgta
gcatagtgtctacaatgttagaggtatttgaaaagtgatagtttattttttggaattatt
tagcattattaaaaacaagggggagcacacggtggcacgtttctggtcccagctacttgg

Exon 11 +      51508      51678   0   Internal    171   100   Excellent
tcactgcaactgtcctggatcaagaggtccgtttctttttcaaaactctttagcattaat
ttcctttagctagtagtctgaaataaaatttttgttttaatttcagtaaatcatgttgtg
caaattactgcatttctctactcctggcaactaaacttatttttattttttatttttcag
GATGATGATGATGGCCACTTGCTGGCTTTGCAGATCATAAGGGATTTAGTAGATAAAGGT
GGTGATATATTTTTGGATCAGCTAGCCAGACTTGGTGTAATTAGCAAAGTGTCAACGTTG
GCAGGTCCTTCCTCTGATGATGAGAATGAAGAGGAATCAAAACCAGAAAAA
gtgagtggtcttaattatagaggtatcaggaagagttttttttttttttttgaggaaaat
ctagtttcaatttttgatggtttttgacaggataatgacaatatgaaataattctgtata
ttttttaaattggtcaattttcttttaaaacattttgatcaacaattttaaacatataga

Exon 12 +      58297      58519   2   Internal    223    81        Good
atgacagagttgagaccatgtttctaaaaggggggaaaaagattaagctacaggcaattg
agtattatgttcagagtatttaaatttgaaattaaattagattcatgtttttaaaatatg
tatgaatatttgaaattgaaattattttccatgtttaattgaataattctacacatttag
GAAGATGAACCACAGGAAGATGCTAAAGAATTGCAACAAGGTAAACCATATCATTGGAGA
GACTGGTCAATCATTAGGGGAAGGGACTGCTTATATATTTGGAGTGATGCAGCAGCCTTG
GAATTATCTAATGGCAGTAATGGATGGTTCAGATTTATCTTGGATGGAAAACTTGCCACC
ATGTATTCAAGTGGTAGTCCGGAAGGTGGATCTGACAGTTCAG
gtaatattttgtttcaattaaaatattttcctagtttctacagtttggtttttttctcat
atttttgctaccattgtcaaggtattttatttttttgagacggagtctcactctgtcacc
caggctggagtgcagtggtgcgatctcggctcactgcaacctccacctctcaggttcaag

Exon 13 +      63577      63711   0   Internal    135    66    Marginal
cagaacatacataggttgtttcctcaaataactgtaacttcgagagctcatttgtgccca
aatgacagtacatacgtaccttttcgtggtgaaatatgtaaatacgagtgtctataaaag
tgaagatttggtaaaattattaattgtaaaaattcacatttgttgtgtttattttggtag
GTACGAACTATGGCTCGAGATTTATACGATGACCATTTTAAAGCTGTTGAAAGCATGCCT
CGTGGAGTAGTGGTAACACTCAGAAACATAGCAACTCAGTTAGAGTCATCTTGGGAACTT
CATACAAATAGACAA
gtatgtcatcctctagattttaatgatatgtagtgaattttagtttgatgtcttcccctc
tatcctttatgtcatgggtattgagtagggggtcagcaaattatggcccaggagccaaat
ctggcctgctccccattttcgtatggctttatgaggtaagaatggtttttatacttttaa

Exon 14 +      64261      64407   0   Internal    147    97   Excellent
actgggccctttacgaaaacgtttgctgacctctggtagacataatttgtgttaataatt
tgaacttttaattttgcttaatatctaaattattgtcatgataattgatgttctgataag
ttattttaagagctatgtttatgtttttgattgccttcattaaatttttttttcttttag
TGTATTGAGAGTGAGAACACTTGGAGAGATTTAATGAAGACAGCTTTAGAAAACCTAATT
GTACTTTTGAAGGATGAAAACACAATTTCACCATATGAAATGTGTAGCAGTGGCTTGGTA
CAAGCACTTCTTACTGTGTTAAACAAT
gtaagtttatcaagtagtaaagaacaaaaatacagttttaaaaattatttgtagttactc
cttcggtagagtggtttttagtttgttttgtcaagaaatatttaaaagctgaatgatgtt
aatatttctaatttcttcagcctttaggttttatgattagtttgagccaaatgaattaaa

Exon 15 +      66566      66660   0   Internal     95    95   Excellent
gcctactagtcacatactaaaaataattttaattgaaacatgaaatgatgaatgatttta
ttcacattgtagtgatcattgtataacaatatgttaacatttgtctcttagtttttgatg
aatttcagtaagatccttaaattatttttttttggactttatactttttgttttctttag
AGCATGGATTTGGATATGAAACAAGATTGTAGTCAACTGGTAGAAAGAATAAATGTTTTT
AAAACTGCCTTTAGTGAAAATGAAGATGATGAAAG
gtaaaatctcaaatttctttgaatttgatgtttgtaatgttcacacagttggtatacttc
ctctaaaataagtctagtgtaacatttatgcacacaaaagaaactcttaataagaaagta
acatattatacatgtataataagaggaaaatttttgaagttttttttaatctaatggaat

Exon 16 +      68521      68671   2   Terminal    151    48    Marginal
attcttaagtaaaggaaattgagttgtgagagtatttctactcagacataatctaataca
aaaattaaactgtagtcatgaaaaagtaggggtatatattgaagttgattaccatatttt
ctgcatgaacatttacatgtagttatacaaaacctcttaataataattatttcttcgcag
TCGACCAGCAGTTGCGTTAATTCGAAAGTTAATAGCTGTACTAGAATCTATTGAACGTCT
ACCTCTCCATTTGTATGATACACCAGGATCCACATATAACCTCCAGGTAACCATAAAAAA
TGTAGTAGCTAGTATTGCTGAATGCATCTAG
gaacagtgtgacacttttctttaaaaaaaattattttctttcacatcggattaaaataaa
aatgattctacttaatctttaaagattttagcttatatgccatttgattgatcttaatga
cttgaagtctgttttgtttgatcaaatcactggaaaatgatgcattcatttaatatttgt

Exon 17 +      71928      71987   0    Initial     60    76        Good
tagttaataaatccaaatctcagttgttttagggtatatcattttttacaattctgagac
agaaaccaagacgttttccagagtattttgatcgtttttgtgtagatacttacaaggaga
ttacgatttcggttggaacgtgcacctggtgaaactgcattgattgacaggactggcaga
ATGTTGAAGATGGAACCTTTGGCTACAGTTGAATCTCTGGAACAGTACCTTTTGAAAATG

gtgagtttctggcaagggcacggtgaaataagcattctgagctgtggtttagccttttag
gacaataatttgggaagtatatatccagagttatggtaatacagtttggcccagtaattc
cattttagaactgatttctacatgaagatgtttattataattttgtaatattgaaatagt

Exon 18 +      72903      73042   0   Internal    140    79        Good
cacccacctccgcctcccaaagtgctgggattacaggcgtgaaccaccgcacccggccta
aatgagcatttgttataataaaagaaaacaattcacattaaagagataggaaaaaagtag
gtaacgtgcttgaaaacagcattattaaggtgactgtctttcatattttctttggtttag
GTAGCAAAACAGTGGTATGATTTTGACCGATCTTCATTTGTTTTTGTTCGAAAATTAAGA
GAAGGACAAAATTTTATATTTCGGCACCAGCATGATTTTGATGAAAATGGAATCATTTAC
TGGATTGGAACAAATGCAAA
gtaagtcagtcattttactttaagctggagtgaccatattcacttggtaaaagaattcta
ggaagtagaataaaattgttagcactctgaatattctgtggtttaaggaattttgacttg
taggtagaagttaagattatccaaattactttttatgaggaaaaaatgtctaaattgcta

Exon 19 +      73323      73547   2   Internal    225    79        Good
gtttaaggaattttgacttgtaggtagaagttaagattatccaaattactttttatgagg
aaaaaatgtctaaattgctaattctagaattgtacttaatataattctgtatttaaaacc
ttgtgcaaatgcaattatcttaacgttgttatttgctaatttttctttatttttgtatag
AACTGCTTATGAATGGGTAAATCCAGCTGCCTATGGACTTGTAGTAGTAACGTCATCAGA
AGGAAGAAATCTACCTTATGGCCGCTTAGAAGACATACTAAGTCGTGATAATTCAGCTTT
AAATTGTCATAGCAATGATGATAAGAATGCCTGGTTTGCCATAGATCTGGGTCTCTGGGT
GATACCATCAGCATATACACTTCGTCATGCTCGTGGTTATGGAAG
gtctgcactgagaaattgggttttccaggtatccaaagatggacagaactggacttcttt
gtatacccatgttgatgactgcagtctcaatgaaccagggttagttgaggagtctttgca
aattggaaaactcactaaagagctttgtttatttttataattttatactctagagctctc

Exon 20 +      75104      75280   1   Internal    177   100   Excellent
aaatgccagtggacaaacacactacctctcattatctggattcgaactttatggcactgt
aaatggagtatgtgaagatcagctaggtaaagagatgatacgaggcttttctaacttact
aaaacaattacttttgtaaaaagtgatttggtttttatttctccaatttctacctgacag
GGAAAGCAGCTAAAGAAGCAGAAGCTAATCTTAGACGGCAGAGACGTCTAGTACGTTCCC
AGGTTCTGAAATACATGGTTCCAGGAGCTCGTGTTATCAGAGGCCTGGATTGGAAATGGC
GAGATCAGGATGGCAGCCCACAGGGAGAAGGCACTGTCACAGGAGAACTACACAATG
gtgagtaggtgctcagcacttttgtgtagaaaatgggtagttaaattttttcttttaaga
taatttataaattgcataaatgtatgagcactgtttagaagaactgttgataccacatta
caaatggaaaaaaggtaaagaaaataagggaaaattttaagttcttgggttttgactaga

Exon 21 +      79070      79694   1   Internal    625    86        Good
atatcgtcaaataattgagtccaaaaatttacatatattttagtgggcagaccttgattg
actatagaaattcagaaaaggacagcactgatgaaaagctgatcccatattgtggagcta
ctgtctgacacgctcctatctgctttctgctgggtctcacaaactcctgtccctttccag
GCTGGATTGATGTCACCTGGGATGCTGGTGGCTCAAACTCTTACCGTATGGGCGCAGAAG
GAAAATTTGACCTCAAGCTTGCACCAGGGTACGACCCTGATACAGTGGCATCACCCAAAC
CTGTTTCATCCACTGTTTCAGGCACAACGCAATCATGGAGCAGCTTGGTGAAAAACAACT
GTCCAGACAAGACATCTGCTGCTGCAGGCTCCTCAAGTAGAAAAGGAAGCAGCAGTTCTG
TGTGTAGCGTGGCCAGTAGCAGCGACATCAGCTTGGGTTCGACCAAAACGGAACGGAGAT
CAGAAATTGTAATGGAACACAGTATAGTTTCAGGAGCTGATGTCCATGAACCAATTGTTG
TTCTTTCATCTGCTGAAAACGTCCCTCAAACAGAAGTAGGGTCATCTTCCAGTGCAAGCA
CCAGCACCTTAACAGCGGAAACGGGAAGTGAAAATGCTGAAAGGAAGTTAGGCCCTGATA
GTTCTGTTCGTACTCCTGGGGAGTCTAGTGCAATATCCATGGGAATTGTCAGTGTTAGTT
CTCCTGATGTTAGTTCAGTATCTGAATTAACTAATAAAGAAGCAGCTTCACAACGACCTC
TTAGCTCTTCAGCAAGTAACAGACT
gtcagtgagttctttgttggctgctggggcccctatgagctctagtgcaagtgtacctaa
cctgtcctcaagagaaacatctagcttggagagttttgtaaggagagtggcaaacatagc
acggactaatgccacgaacaacatgaatctaagccgaagcagcagtgataacaacactaa

Exon 22 +      84894      85006   2   Internal    113    89        Good
tggttcagtggtctgcaggtgtaagtttctgagcaattataaattgtcttctggatgttc
ttcaggaatataaagtattttgttttctatcctttgtgcaattctgatattatattttac
tattttttccagatccagtaaaaacttctgttataatccctttagtcctctttttttcag
TTTTTATGAAGAACAGTTTGTCAGCATCTTCATTTATGCAGGACAATGTAATTTGACCCA
GTCTCCATCGAAGGCAAGAGATTATAAGAAGGAAGGAGATAAAAATGATGCAA
gttgttttgaacttccttatgtgctagataatatggataacatgaaagatgccacataca
ttattccgtagtaaataggcattatcttaagtagtcattgtttttaagtaacctaccagg
tcacatatctaagccccgtttttcactgattgacttaattctgtttttcctcgtaagatc

Exon 23 +      85484      85598   2   Internal    115    99   Excellent
cttgtttttgtcatgcttgtgtctgtgctcatcttgtatgtggtggcagaacgcaacagt
tgtcccttttgaattttacttttgttttgtaaaaacctaaaatgcaaagttcctttgtta
tgctttcttaattgtgttgacataaggttgtgggttttgttttcaagatttccttgatag
CTGCCGTGCCAGTACTCTATTGGCTGAGCTCGATGATGATGAGGACTTACCTGAGCCAGA
TGAAGAAGATGATGAGAATGAAGATGACAATCAGGAGGACCAAGAATACGAGGAG
gttatggtagagagagtaccccattctctttacaaagataggatgttaataattgaaatg
aagaaaggaaaagctaagtcataatcaaactttgaagcaaggaaatgtggcaccagtata
aaaaatgtagttaattaagaaaagcagttttaatctgagcatttatgattctccacttaa

Exon 24 +      87013      87135   0   Internal    123    65    Marginal
agtataaaatgcatgatgaatttaaaacattgaactcataacttttctgaagttggctaa
tgaaaaagttttcagtgacacttttgttaataggggttaatatattcaggtcatggctga
aagggggcatatatgggtcaaataattagacatgtatctcttgggattgttttattttag
ATTCTGAGACGCCCATCCCTGCAACGTCGAGCTGGCTCCCGCTCTGATGTAACGCATCAT
GCTGTTACCTCGCAGCTACCACAGGTACCTGCTGGAGCAGGGAGCCGACCTATTGGGGAG
CAG
gtaatatcttcatgtttatcttccctaccatatgtatatttttcccttttatagtaaagc
accaacctaaatgcctacaaaaatgtgcagtgtggaaggggtgagaggagggagctacca
aacagttacacaaagaaacttcccctactggttgggtttcatattctatatagaatccat

Exon 25 +      88652      88808   0   Internal    157    91   Excellent
cttactttgggtaaactgaaatgatgaagaaatgtatgtatctatacatgtttaggttag
ctcattttgggtttaagaaatatggctaaggaaatgcagtagttctaaataacacattgc
ttttgcaacaatgaaattttgcatcttattatgtttgtgtgtgaaattttattttgatag
GAAGAAGAAGAGTACGAAACTAAAGGAGGACGCCGGAGAACATGGGATGATGATTATGTG
CTAAAGAGACAGTTTTCTGCATTGGTTCCTGCTTTTGATCCTAGACCTGGTCGTACTAAT
GTCCAGCAGACAACTGATCTAGAAATACCACCCCCAG
gtacagaatgttttggttttgtgatttaattttaatacatactaaatcagatatgaaaag
tagggtgttgcttttgtatgcacgttattaaaaatttttttttagttttgtgtatgcagg
ttataaaaaatttttttagtcagccacaaattctttaaaaagtaaaggtttttttaaagg

Exon 26 +      92060      92286   1   Terminal    227    56    Marginal
aaaaaaagaaacagaaagcaaaaatgtcgacgcctagagagtcttaagtagctgacatcc
tttagctaatatatggcagagaggtttggatttcatgtagccttgtttcctagtgtagtg
gcctttcttggactgcttgttttagtataattgtttttcacccatcttccaaatttttag
GGACCCCTCATTCAGAGCTCTTGGAAGAAGTCGAATGTACTCCGTCACCTCGATTAGCTC
TCACTTTGAAAGTAACAGGTCTTGGAACGACTCGTGAAGTTGAATTACCACTCACCAATT
TCAGATCAACCATCTTTTACTATGTACAAAAATTGCTTCAATTGTCCTGTAATGGCAATG
TGAAATCAGATAAACTTAGGCGTATTTGGGAGCCCACATACACGTAA
gaaattttaacttaatgttttggtagataatgtcctagtgtagagccaagaagcattgca
tttattttggattataggaacagaaaagattttgtttttattctgttggcttacaggaac
agataatagtgtttgggactcttggtgtagaatgattaagttttagaagtagaaggacat

Exon 27 +      93572      93641   2   Terminal     70    54    Marginal
tgttatttctatccttctttccatctagacacagagaacctgtttcttatcccattgtat
ttttacaacagttatagccatgtgctatgtaacaacttttcagtcagtgatggaccatgt
atgacaggggtcccataagattataaaaccacatttttactgtaccttttttatgtttag
ATACACAAATACCATTGTGTTACAGTTGCCTATTCAGTACAGTGATATGCTGTTAAGGTT
CGTGGCCTAG
gaaaaataggctataacacatagcctacgtagatagtaggctataccattttgttttgtg
taatgtactcagtgatgtttcacaaccaccagatcacctaatgctgcataacacttgata
cagtcatatctttaaaagttctagatttgatacatgctttctttgtaataatgataaatt

Exon 28 +      94170      94232   0    Initial     63   100   Excellent
agcctggacaacatagcaaaaccttatctctacaaaaaatatagaaaaaaagaatcctcc
ttgagttcagtgttcagtgcaggcatatgtctagtgaatgacattcacttttttttttaa
agaattgaagccttattggaaataatcacaaattatatatgaattaacttgaatatcttc
ATGTTTAGAATCATGTACAGAGAAATGAAGGATTCTGATAAAGAAAAGGAAAATGGAAAA
ATG
gtaagttattttagaacattggtttactcttggctatttagttaaaagaagaaagatagt
aaaactaacacagtattgcagttgaacgttgaagggaataatgactaacatggaattctt
tagattagaccaagtgcatgatcttaaagctacctcatgtaatgcatgtgaaatatcata

Exon 29 +      94459      94615   0   Internal    157    99   Excellent
agaagaaagatagtaaaactaacacagtattgcagttgaacgttgaagggaataatgact
aacatggaattctttagattagaccaagtgcatgatcttaaagctacctcatgtaatgca
tgtgaaatatcatagactttataattgggaaaggccaacatttggtttttcctgttgtag
GGTTGCTGGTCTATAGAGCATGTGGAGCAGTACCTTGGCACTGATGAATTACCAAAGAAT
GACTTGATAACCTACCTGCAGAAGAATGCAGACGCTGCTTTCCTGCGCCACTGGAAATTA
ACTGGCACTAATAAAAGTATTAGGAAAAACAGAAATT
gttctcagctcatagctgcatataaggtatatattggcatcaaaacactattttgattgc
aaatggcttcgtgctttgttttgcagctttggaagcttcttaaggaacagcagttcattg
agacataattttaaaaatgaggttgaattaacactgttaatgcacaaattctaaaatttc

Exon 30 +      95034      95245   0   Internal    212    61    Marginal
atattttatttgggaattttaatggtttagaatgccttgatttatgtcttgtgttatgtt
tttatttaaaaagaaggcactttaaaaaattccaaccctttcatagtggtattgatacaa
tgatacactgtttttcttgaaaatgtgattaatggccagtttttctaattgtttctatag
GATTTTTGTGAGCATGGAACAAAGTCTGGGTTAAACCAGGGGGCCATTTCTACTCTTCAA
AGTAGTGATATTCTTAATTTAACAAAAGAACAACCTCAGGCCAAAGCAGGCAATGGACAG
AACTCTTGTGGAGTAGAAGATGTCCTTCAGCTTCTGCGTATTCTATATATAGTTGCAAGT
GACCCTTATTCAAGAATATCCCAGGAAGGTCT
gtaagaagccttgtttcatttctatagcagttttaaagcaagtcagtttatatttttatt
aattttattaattaattttatagatggtgatgaacagcttcagtttacttttccaccaga
tgaattcactagcaaaaaaattacaacaaaaatattacagcagattgaggtaataaaatc

Exon 31 +      95329      95414   1   Internal     86    83        Good
gacagaactcttgtggagtagaagatgtccttcagcttctgcgtattctatatatagttg
caagtgacccttattcaagaatatcccaggaaggtctgtaagaagccttgtttcatttct
atagcagttttaaagcaagtcagtttatatttttattaattttattaattaattttatag
ATGGTGATGAACAGCTTCAGTTTACTTTTCCACCAGATGAATTCACTAGCAAAAAAATTA
CAACAAAAATATTACAGCAGATTGAG
gtaataaaatcagacagctgaactcttcattctattactgttggacttttcctaatattc
cctttactttcttttctacctctcaccatctttcccttccctctgattggtaatttgagc
tatatggtcctttgcatttatttcctaattacaggtttataattgacttggtaattttta

Exon 32 +      98920      99160   2   Terminal    241    57    Marginal
catatatttttacttgtgacaggaagcagtttatgtaacaaaaaaagattactgtgtttt
aaaaatcacctgataaaatactattttttaatttcttaaatctttgaattctgttgctgg
tttagtagtacattcagctgttaacgtatgctgcagctcatagatatttttctatttcag
AGCAATAGTATGGTTACAGAACCGACGTGAAGCCACTGTGGAGCGAACGAGAACCACAAG
CAGTGTTAGGCGAGATGACCCTGGAGAGTTTCGAGTTGGTCGTCTCAAGCATGAAAGAGT
AAAAGTTCCACGTGGCGAGTCACTGATGGAATGGGCTGAGAATGTCATGCAAATACATGC
AGATCGGAAATCAGTTCTTGAGGTAATCTCATATAAAATTAGATTTAGGGAACAGGAATG
A
cacttagggaaccagcccaatgtgtatcttcactgcattaaaaactgtggtaggtaaaca
tgaagaggggttttcctgttctgtaggcagaagccttctcctctggcagagcatcttttt
cataagaggatgtcagtccacctccttaggggttaggtcttgtgccattaatgagcaaca

Exon 33 +     100814     100951   0   Internal    138    96   Excellent
gtggactctttaggaaaattaaaataacacttctgtgctgtttattatatatatacactg
ctattttgaaaaaaggtacattactggatcagatatgataaattttgacaagaattagat
tatttttaaaaacaccccaaactttacgtttaacccacaatttatttgttcatattttag
GTTGAATTTTTAGGAGAAGAAGGAACTGGCTTGGGACCCACATTAGAGTTTTATGCTCTG
GTGGCAGCAGAATTCCAGAGAACTGACTTGGGAGCTTGGCTTTGTGATGATAATTTTCCA
GATGATGAATCTCGTCAC
gtaagaatatttctcattttgtgacttgagttgtgactctgctttcaaaagtgttaaaaa
taggttatgtgttcagagcataagccaggtttctgactctacttttattattgaataatc
ttgatgcaattaaaatagttctaaagcgataaaatttagtcaccaaaagctatttaataa

Exon 34 +     101265     101876   0   Terminal    612    55    Marginal
aatagttctaaagcgataaaatttagtcaccaaaagctatttaataaaattatatacttt
tagatagccaaattcatgaagatgtttaatgtttatggatttttttcttagatgatgata
ggcttagtttctattaacttttgtttaattttatttgcatttcaccctctaaaaaattag
GTTGATCTTGGAGGTGGATTGAAACCTCCTGGATATTATGTGCAGAGGTCATGTGGACTG
TTCACAGCACCATTTCCACAGGATAGTGATGAGCTTGAAAGGATCACGAAACTGTTTCAT
TTCCTTGGAATTTTCTTGGCCAAATGCATTCAAGACAATAGACTTGTGGACTTACCTATT
TCTAAACCTTTTTTTAAACTTATGTGTATGGGTGACATTAAAAGCAATATGAGTAAACTG
ATTTATGAGTCACGAGGTGATAGAGACTTACACTGTACTGAAAGTCAGTCTGAAGCTTCT
ACAGAAGAAGGTCATGATTCACTCTCGGTAGGAAGCTTTGAAGAGGATTCAAAATCAGAA
TTTATTCTTGATCCCCCTAAACCAAAACCCCCAGCTTGGTTTAATGGAATTTTGACTTGG
GAAGACTTTGAATTAGTAAACCCACACAGAGCCAGATTTTTAAAAGAAATTAAAGACCTT
GCTATCAAGAGGCGCCAAATTTTAAGCAACAAAGGTCTTTCTGAAGATGAGAAGAACACA
AAATTACAGGAACTAGTGCTGAAGAATCCATCAGGTTCTGGGCCTCCACTTAGCATAGAG
GATTTAGGGTAA
gcattatatgtacattcttcaatccaatgcatgaataagttttaaagcttttgtttcttt
gtcgtcactgatttgcaatatatgagtaaatagtctgtcaaaaacagtaatatgctgtag
gaaatattgatgatcgacttgaacctttgatttaatattataaagacaacactcagaata

Exon 35 +     103042     103135   0   Internal     94    86        Good
gttttgcccttcctcaagaatatatggttttacagctgtggatctcaagccaagtggtga
agatgaggtaaaaagtttgcttttaatatagttgtaagttctgacatatcctcttagcaa
ggccagttgtactagacactcctgaaatattcctagatactgacaaattttcttttgcag
ATGATAACAATGGATAATGCAGAAGAATATGTGGATTTGATGTTTGACTTTTGTATGCAT
ACGGGTATTCAGAAACAAATGGAAGCCTTTAGAG
gtaattttaaaggatttttagcataattgctctcctttcactttgagacagttgaaatta
tggtcaagaattgctggtggtcggctgggcacggtggctcacacctgtaatcccagcact
ttgggaggctgaggcgggaggatcacctgaggttgggagttcgagaccagcctgaccaac

Exon 36 +     105439     105602   0    Initial    164    52    Marginal
attcttttttatggttgcatagtattccattgtgtacatataccacattttctttacaca
ttcatcccttgatagatacttagattgattctgataatgggtattttggtttgaaatttg
gtattttggaatcgtaacttggaaactgagttgtatgtttgttttttgtgtttccgttac
ATGTACGATGTAGATGGGTTTAATAAAGTTTTTCCAATGGAGAAATTAAGTTCCTTCAGC
CATGAAGAAGTCCAAATGATTCTTTGTGGAAACCAGTCACCATCCTGGGCAGCAGAGGAT
ATTATCAATTACACTGAACCTAAGCTGGGTTATACACGTGACAG
gtatgtgatactattttccaagatcaacaaaattatttatattccccaaatcaaatgaca
gattctctaaagaactttaattcagtgagtatcataaagtaagtgagaaagcagtggtgt
ctcacagttaccagaatgcatatccactgataaggctgggaggatacaaaaagacaactg

Exon 37 +     107451     107588   0   Terminal    138    84        Good
ctggttgttcaactctacccccaggtggactggctaacctgcatcccaggctcacggttg
tacgcaaggtacaagctctctggctaatggggaatccaaatgaaatttagttactttact
tttgaaagaaagaagtatttaaactcatggtcttctgttgtgtttgctttcttgttgtag
GTTGATGCTACTGATGCAAGCTATCCATCAGTCAATACATGTGTGCATTACCTTAAGTTG
CCTGAATATTCTTCCGAGGAGATCATGAGAGAGCGCCTGCTAGCTGCTACAATGGAGAAA
GGCTTTCATCTCAATTGA
gctttgaagtgcaatgggagacatcagagactttaaaaatactagtgaagcctcttgtgt
ttgtgtgcagagaagtatatgatccaccatgctaatgacacttgcctttttttccaccat
taaggctttaagaacatgtggaataagttttttagctgctaatgacaaaacaaatcctgt

--------------------------------------------------------------------------------